Gene detail

Detailed information of gfas1.m1.596.m1 in Galaxea fascicularis

Genomic Location: Sc0000011:50044...67068
NR annotation: KAJ7387179.1, hypothetical protein OS493_004146 [Desmophyllum pertusum]
Species Galaxea fascicularis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gfas1.m1.596.m1

CTCTCCTTTATCCTGTTGGCTCTAAGCGTCACGGATTTTGTTTTCGCTTCATTATCAAGCAAAAACAACCCGAAGCTGTCCTTTTTTGCCTGTTATGGGCGCTGGTGGCATCAATGGGGAATTAAGAGATCATTCAGAACAAGTCAACGCGATTTTACGGACGCATTTTAATGTAGCGAACGCGAACAGCCAAACTTCTTCCTCGTCTGCATCTTCTAACAGTGTCCCCGCTGAACACCCAGGTTCCACAAGCACTTTCAACTTTCCGGAGGACGCTTTCGAAGATATGGCATGCTTTAATTGCAGCTCCAACTTTTCGATTTTCAGAAGGAAGAATCTCTGCCAGAAGTGCAAGAGACATTATTGCAATGAATGCTTTGCCAAGGAGACCAAATTTGCTCCTGGGGAGAACACAAGACACTGTTTGACTTGTCGTGCTCTGCAGTCTCCAGTTGCATACAAGGATCACTTGAAAAGGCTGAAGATTAAAGACCTACAAGATTATTTGAGGGCTAGGCAGATATCTATGGATCAATGTAAAGAAAAAAGAGATCTCATAGAGTTAATTTTGCGGCATGCTGAAGAAAGATCAGCTACAGTGAACCCCACTTCAAACTCTCAAAATCAAGCAAGGCAGCAGACTCGAGCAAACCCACCACAGGTCAACTTACAGAGGCCAACTCAACCCAGAAGTTTAAATTTTTATCCACCATCAAATTCACAGCCTGTTCAGGTCCCTCCATCAGCTCCACGGCCCTCTGGATGCAAGAGTCTGAGTCAAATTCAAAACATTGAAGAAGTTGAGGAGCTTTCTGTGAAGGAGCTCAAGCGAATTCTTGCTGCTAACTTTGTCGACTTTAAGGGATGTTGTGAAAAGAAAGAACTCTTAGATCGTGTTAGAACCCTCTGGCATTCCAAGCAGGAGATTAATAAACGAAAAAGTTTTATGGGCCCTGACGAAGTGGAAGAATTTGAGGACCAATGTAAAATTTGTATGGATGCAAGAATAGACTGTGTGTTACTTGAGTGTGGACACATGGTTACTTGTACCAAATGCGGCAAACAGCTGACAGACTGTCCCGTATGCCGGCAGAATATAGCTAGAATTGTACATATGGAGTTCGAGGAATTGAAAGTTGAAATACCCGTCGATGATGGCGAAGAAAACGAAAAAGAATTCCCTTTTAACTTGGAAAGGCGATATGAAAACAAGTCTGGTTGTTTTGTGACAGGATTTGACGTTACTTCAAAGGAAGCACAAGAGAGGAAAGCCAGAAGAGCAAAAAGATTTGGACTCCAACCAAAAAAGAAACATGATGGTGAAAGTGAAGACCAGTCAGATCAGGACACAGATACCAAATTATCGTCCATTGATGTCAAAGACCTTCCATCCATTTCTGATGGAGAAGCAAGGCAAGATGCCATTCTTATTCATGGTGTTGATGACATGAGCACAAAGGATGTGTTTTCATATTTTAACACTTTTGCACCTGGTTCAGTTGAATGGATTGATGACTCTTCTTGTAATGTAGTGTGGGATGATGACTATACTGCATCAAGAGTTCTAATGGAAATAGGAAAAGATATAGAAGGACATATTCTCGCAGATGATGAAATGAGTGATTCTACTGAAAGCAGATGGAAAATAGGACCGCCTCATCCAAAAGCAAATTGTCTTCTTTTACGATTAGCAACCAAAATCGAATCTGAACAGGAGGAGAAAATGGAAATAGACGAACCACCTCTTAAGATTATGGTAACCAATGATGGACCCGTGGAGAAGAGCGAGCCATCCAATCTACGCATGCGTATGTATGCTGATTCTGTCGAAGACGATGACAGTGAAGACGAGAGTGACGACGATAGAAGAGAAAAGAGAGATGAATGGAAAGGAAGGATCGAACGAAAGCAAGAAAAAAAGGAAGAAAGTAAACCGCCTAAGATTCTGGACTTACGACAGAAGTTAATCAGTAGGGAACGTCACGGATTCAATTTCAAGAATAGACCATCTCTATCTATAGAAATCAAAGAGGAACCGGCTTCTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99KR6	E3 ubiquitin-protein ligase RNF34 OS=Mus musculus OX=10090 GN=Rnf34 PE=1 SV=1
Q6AYH3	E3 ubiquitin-protein ligase RNF34 OS=Rattus norvegicus OX=10116 GN=Rnf34 PE=1 SV=1
Q969K3	E3 ubiquitin-protein ligase RNF34 OS=Homo sapiens OX=9606 GN=RNF34 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008993 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10309 all species →	NCBP3	Nuclear cap-binding protein subunit 3	Family	Interproscan
PF13920 all species →	zf-C3HC4_3	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR036361 all species →	Homologous_superfamily	SAP domain superfamily	Interproscan
IPR019416 all species →	Family	Nuclear cap-binding protein subunit 3	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR051728 all species →	Family	RING-FYVE domain-containing E3 ubiquitin-protein ligase	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14879 all species →	CASPASE REGULATOR, RING FINGER DOMAIN-CONTAINING	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000340 all species →	Molecular Function	RNA 7-methylguanosine cap binding	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0043161 all species →	Biological Process	proteasome-mediated ubiquitin-dependent protein catabolic process	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan
GO:0070936 all species →	Biological Process	protein K48-linked ubiquitination	Interproscan
GO:1902042 all species →	Biological Process	negative regulation of extrinsic apoptotic signaling pathway via death domain receptors	Interproscan
GO:2001271 all species →	Biological Process	obsolete negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for gfas1.m1.596.m1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of gfas1.m1.596.m1 across 22 RNA-seq samples of Galaxea fascicularis. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

22Samples

21TPM > 0

4Conditions

140.0Max TPM

60.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
coral holosome · Control	7	7	63.16	75.76
coral holosome · 30ic treatment	6	5	60.97	140.03
coral holosome · Prometryn (herbicidess) treatment	5	5	62.51	91.55
coral holosome · Prometryn (herbicidess) and 30ic treatment	4	4	50.40	56.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR27118491	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	75.76
SRR27118488	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	75.69
SRR27118492	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	70.63
SRR27118480	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	60.97
SRR27118486	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	59.75
SRR27118487	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	56.31
SRR27118485	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	42.98
SRR27118468	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	140.03
SRR27118479	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	61.49
SRR27118476	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	60.94
SRR27118478	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	56.33
SRR27118466	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	47.05
SRR27118477	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	0.00
SRR27118482	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	91.55
SRR27118484	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	75.66
SRR27118481	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	60.70
SRR27118469	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	44.39
SRR27118483	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	40.22
SRR27118472	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	56.04
SRR27118475	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	54.11
SRR27118489	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	53.84
SRR27118490	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	37.62

Source: CnidoSite RNA-seq expression matrices (GFASC_TPM, StringTie quantification over 22 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.