Gene detail

Detailed information of scaffold167.g16.t1 in Aurelia aurita complex sp. Pacific

Genomic Location: scaffold167:232945...239454
NR annotation: no NCBI-NR hit recorded
Species Aurelia aurita complex sp. Pacific · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

scaffold167.g16.t1

gtttgttagataatcagatatcaatttacttcagatgcattgaggcattcagagtattttcatgtttacacgcggacaacaaattttggagaaatatttatttgaaccaagattgcaaaatgggagctatcgtttcagtaaaggagcgagcgaggaagaaaactatggcacttacagcttttgaaggaaaagttttacgaaagcaggaaggatatgatactgctggagtgcgtcatcataggcagacaaccgtgggtgtcgatgtgaaattccgcaataaacttcaaaacaagcatgaaatcggagctgtaaatgaaacagaaactgctgcaatattccatgatattaaaaatgttcatcaaaaacaagaggccgctggaggaaacgaaaaattaaacgtgcgaagttatggcactggagagagcaacacaacaactctttgtcgcgcttgtagccatggtaatcaaacgactgcgctaaatattaccatggcaccccgagatgaacgtcaaattgtgccagagaaatgctcaaaagcggtggaaataggagagacgaagcagacctctggagataaaccaaaaatcgttcgacatgatcgtgttagtgttaggcctgtttcagataagaataatcacgagggtcatcatcctaacccttgtggtgaagatgaccctggtgaaattcacagtttgcagcattcaaatgaagccatggttaaccccacaggcacagctaaacccacaccccctgccaaatacagcgcaaaaatcccacctcgccctccagcatcccctgtcaacttcgctttggggtcttggggggagggtgttgttggtaccagtgatcatgtgttaaaaagtagaggtcaagtgacatcaagaggcttggatgttgctgtcaagagcagtgcagatttttatagtgatttcgcgtatgttagttcatatgctccgcctgtgccgcctagtcccagagaaagacagacaagagacaagccccataaaactgaaaattgtaattgtaggatttgtgctgacgctagacgaagagaaagggcagctgtgaagatacaaagtcaccttcgtggttatcaggcgaggaaagatgtgatgcgaaagaaagttagcgttgtgaagattcaacggatttatcgcaagaaggctgcaactcgactaagtaccctgagggaaccatccataagccctcgaagaagcaaaacaccgcaaggctctcgcaaacatttgttggaatcttcaacgcatactcccgtcttcgaagctgaagtaggcgaagaaactaaagagaatttggaactgtaccaggaggacattacggagttaaaatggcaaagccagcagttaatagagatttcaactatgggtgatagctatgagcctcagaaagttttagttatctcctcgaccgttcctaaacctgattggcttgtgcgcgtaacactccaagacgtacacgtgattctgtatcagtttaaagagatcaatttgagagacattttagacaatatagtactgtcactcaatgactattgcgtcggcagtaaagcaaggagaattgcttttgtggtccagggcggccccggatacatgtatctttgcagaggaaaagttttaacatcggcaaagctaaagaaggacaaacagctgcaatattttctcaaagaacttgggactcttattagcaaaaaagaccctcttgatgcaaaagttcatatcatagggaataatattcttgggaacaagaaaggggtacaactgctggaagatattcgcgatgctatgaaaccatgcagagttgcaattgaatctccgtttgaaatgtcgttagatgggtttaaaatgctgaacgattatttcgatgttgatctttataaagtatggaaaaggaatcgatacagtaaaattaatatttagatacggtatttgctcagggcagcattgccgttaataaattttttgatacattttccaatgcaggtaaatgtggtaacatgctggcagcatgttaccacatggtaacaaatattcaattcacacacattagctgttgtttttttgtcgtgttgcggtgtttctgcctgcaaatttatcacgtttatctgcatttgaaagtgcatatactgtacatgcttactatagatgaaatacggcaaacatttccaaagcaaaggaacatatatttgcaggattaaggattcattaaatttgtgtctgtgtcagcattatatctatttaaaactggatagatttttaacatttacatgaatggtaatgtatttttctaaaaattgcgttgctgaatggagatatctgatttaggacactcattggatttggtttttaaaggtttcttatctacttctacattcttctatctggcctgaagtgtccaaaactaaaatgttatttctacgaacacctctgaaagttcaaatgaaaattgcatcaaagagtaaggagtagacttttttccatatgattctgtactctgagcctctttcgtgtttgataacagtttttctcccaagtaaagatcttcagcaattctacttcctcaaagttagttgacggagctaagtacaggcaatctataaatagggcaaagaaagacctatgcacataattgctcccaaggtgagaagatatgcatgcacctgtcgatatcatcaaatacaataggctaatcttagacatgcaaatgcatctcttgggtagctgtttatctccatcaactaactttgaacttggtcaaagacttgatagaggttagaaaaatttagttatcaaggcttgcagatgagatctcccctcgtaagtccccatatatttacatcataatctattgtaggaatttttgtgtattgttgaagtaattcttgtattttcttctacaacctgggataaactaatttcgtcttagcaacaacaactccatctgcatcaccatacaaatattgtcctgggctgaatgacacctcaccaaactcaacaacaacatctctgaacccctggttgcgttttattgttttccttggatttgttgccaaggctttcactccaatatccatcatagaaataatctctgagtctcgtaaacatccattgattacaactccactccagctgtttttgatagcagctgcagcaagattgtccccaagtagtgctctgctcatggagccagctccatcaacaacaaggacctaaaacatggaatacactgattctaatttt

Transcript

scaffold167.g16.t1

GTTTGTTAGATAATCAGATATCAATTTACTTCAGATGCATTGAGGCATTCAGAGTATTTTCATGTTTACACGCGGACAACAAATTTTGGAGAAATATTTATTTGAACCAAGATTGCAAAATGGGAGCTATCGTTTCAGTAAAGGAGCGAGCGAGGAAGAAAACTATGGCACTTACAGCTTTTGAAGGAAAAGTTTTACGAAAGCAGGAAGGATATGATACTGCTGGAGTGCGTCATCATAGGCAGACAACCGTGGGTGTCGATGTGAAATTCCGCAATAAACTTCAAAACAAGCATGAAATCGGAGCTGTAAATGAAACAGAAACTGCTGCAATATTCCATGATATTAAAAATGTTCATCAAAAACAAGAGGCCGCTGGAGGAAACGAAAAATTAAACGTGCGAAGTTATGGCACTGGAGAGAGCAACACAACAACTCTTTGTCGCGCTTGTAGCCATGGTAATCAAACGACTGCGCTAAATATTACCATGGCACCCCGAGATGAACGTCAAATTGTGCCAGAGAAATGCTCAAAAGCGGTGGAAATAGGAGAGACGAAGCAGACCTCTGGAGATAAACCAAAAATCGTTCGACATGATCGTGTTAGTGTTAGGCCTGTTTCAGATAAGAATAATCACGAGGGTCATCATCCTAACCCTTGTGGTGAAGATGACCCTGGTGAAATTCACAGTTTGCAGCATTCAAATGAAGCCATGGTTAACCCCACAGGCACAGCTAAACCCACACCCCCTGCCAAATACAGCGCAAAAATCCCACCTCGCCCTCCAGCATCCCCTGTCAACTTCGCTTTGGGGTCTTGGGGGGAGGGTGTTGTTGGTACCAGTGATCATGTGTTAAAAAGTAGAGGTCAAGTGACATCAAGAGGCTTGGATGTTGCTGTCAAGAGCAGTGCAGATTTTTATAGTGATTTCGCGTATGTTAGTTCATATGCTCCGCCTGTGCCGCCTAGTCCCAGAGAAAGACAGACAAGAGACAAGCCCCATAAAACTGAAAATTGTAATTGTAGGATTTGTGCTGACGCTAGACGAAGAGAAAGGGCAGCTGTGAAGATACAAAGTCACCTTCGTGGTTATCAGGCGAGGAAAGATGTGATGCGAAAGAAAGTTAGCGTTGTGAAGATTCAACGGATTTATCGCAAGAAGGCTGCAACTCGACTAAGTACCCTGAGGGAACCATCCATAAGCCCTCGAAGAAGCAAAACACCGCAAGGCTCTCGCAAACATTTGTTGGAATCTTCAACGCATACTCCCGTCTTCGAAGCTGAAGTAGGCGAAGAAACTAAAGAGAATTTGGAACTGTACCAGGAGGACATTACGGAGTTAAAATGGCAAAGCCAGCAGTTAATAGAGATTTCAACTATGGGTGATAGCTATGAGCCTCAGAAAGTTTTAGTTATCTCCTCGACCGTTCCTAAACCTGATTGGCTTGTGCGCGTAACACTCCAAGACGTACACGTGATTCTGTATCAGTTTAAAGAGATCAATTTGAGAGACATTTTAGACAATATAGTACTGTCACTCAATGACTATTGCGTCGGCAGTAAAGCAAGGAGAATTGCTTTTGTGGTCCAGGGCGGCCCCGGATACATGTATCTTTGCAGAGGAAAAGTTTTAACATCGGCAAAGCTAAAGAAGGACAAACAGCTGCAATATTTTCTCAAAGAACTTGGGACTCTTATTAGCAAAAAAGACCCTCTTGATGCAAAAGTTCATATCATAGGGAATAATATTCTTGGGAACAAGAAAGGGGTACAACTGCTGGAAGATATTCGCGATGCTATGAAACCATGCAGAGTTGCAATTGAATCTCCGTTTGAAATGTCGTTAGATGGGTTTAAAATGCTGAACGATTATTTCGATGTTGATCTTTATAAAGTATGGAAAAGGAATCGATACAGTAAAATTAATATTTAGATACGGTATTTGCTCAGGGCAGCATTGCCGTTAATAAATTTTTTGATACATTTTCCAATGCAGGTAAATGTGGTAACATGCTGGCAGCATGTTACCACATGGTAACAAATATTCAATTCACACACATTAGCTGTTGTTTTTTTGTCGTGTTGCGGTGTTTCTGCCTGCAAATTTATCACGTTTATCTGCATTTGAAAGTGCATATACTGTACATGCTTACTATAGATGAAATACGGCAAACATTTCCAAAGCAAAGGAACATATATTTGCAGGATTAAGGATTCATTAAATTTGTGTCTGTGTCAGCATTATATCTATTTAAAACTGGATAGATTTTTAACATTTACATGAATGGTAATGTATTTTTCTAAAAATTGCGTTGCTGAATGGAGATATCTGATTTAGGACACTCATTGGATTTGGTTTTTAAAGGTTTCTTATCTACTTCTACATTCTTCTATCTGGCCTGAAGTGTCCAAAACTAAAATGTTATTTCTACGAACACCTCTGAAAGTTCAAATGAAAATTGCATCAAAGAGTAAGGAGTAGACTTTTTTCCATATGATTCTGTACTCTGAGCCTCTTTCGTGTTTGATAACAGTTTTTCTCCCAAGTAAAGATCTTCAGCAATTCTACTTCCTCaaagttagttgacggagctaagtacaggcaatctataaatagggcaaagaaagacctatgcacataattgctcccaaggtgagaagatatgcatgcacctgtcgatatcatcaaatacaataggctaatcttagacatgcaaatgcatctcttgggtagctgtttatctccatcaactaacttTGAACTTGGTCAAAGACTTGATAGAGGTTAGAAAAATTTAGTTATCAAGGCTTGCAGATGAGATCTCCCCTCGTAAGTCCCCATATATTTACATCATAATCTATTGTAGGAATTTTTGTGTATTGTTGAAGTAATTCTTGTATTTTCTTCTACAACCTGGGATAAACTAATTTCGTCTTAGCAACAACAACTCCATCTGCATCACCATACAAATATTGTCCTGGGCTGAATGACACCTCACCAAACTCAACAACAACATCTCTGAACCCCTGGTTGCGTTTTATTGTTTTCCTTGGATTTGTTGCCAAGGCTTTCACTCCAATATCCATCATAGAAATAATCTCTGAGTCTCGTAAACATCCATTGATTACAACTCCACTCCAGCTGTTTTTGATAGCAGCTGCAGCAAGATTGTCCCCAAGTAGTGCTCTGCTCATGGAGCCAGCTCCATCAACAACAAGGACCTAAAACATGGAATACACTGATTCTAATTTT

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009227 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00612 all species →	IQ	IQ calmodulin-binding motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000048 all species →	Binding_site	IQ motif, EF-hand binding site	Interproscan
IPR033374 all species →	Family	NMDA receptor synaptonuclear signalling and neuronal migration factor	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32061 all species →	NMDA RECEPTOR SYNAPTONUCLEAR SIGNALING AND NEURONAL MIGRATION FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0048168 all species →	Biological Process	regulation of neuronal synaptic plasticity	Interproscan
GO:2001222 all species →	Biological Process	regulation of neuron migration	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23844	NSMF; NMDA receptor synaptonuclear signaling and neuronal migration factor	-	Signaling proteins	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of scaffold167.g16.t1 across 29 RNA-seq samples of Aurelia aurita complex sp. Pacific. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

29Samples

15TPM > 0

28Conditions

12.8Max TPM

2.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
jellyfish mesoglea cells	2	1	0.48	0.96
complete polyp induced 20h	1	1	2.73	2.73
jellyfish canal system endoderm	1	1	2.40	2.40
mesoglea cells	1	0	0.00	0.00
bell edge (ectoderm and canal)	1	0	0.00	0.00
tentacles (distal part)	1	0	0.00	0.00
planula complete	1	1	6.62	6.62
male gonad	1	1	3.74	3.74
jellyfish ectoderm (upper bell surface)	1	1	3.20	3.20
jellyfish ectoderm (muscle layer)	1	1	1.25	1.25
complete juvenile jellyfish ~1cm in diameter	1	0	0.00	0.00
strobila foot	1	0	0.00	0.00
jellyfish ectoderm from the upper side of the bell	1	1	12.79	12.79
complete juvenile jellyfish ~2.5cm in diameter	1	0	0.00	0.00
jellyfish striated muscle layer	1	1	2.14	2.14
strobila head	1	0	0.00	0.00
jellyfish gastric filaments	1	1	3.29	3.29
jellyfish bell edge	1	0	0.00	0.00
jellyfish oral arm	1	1	0.25	0.25
jellyfish bell middle part	1	1	2.50	2.50
polyp ectoderm from body column	1	1	10.80	10.80
polyp head region	1	0	0.00	0.00
polyp endoderm from body column	1	1	2.76	2.76
strobila non-segmented part	1	0	0.00	0.00
strobila segments	1	0	0.00	0.00
complete polyp induced 12h	1	1	5.05	5.05
complete polyp not induced	1	0	0.00	0.00
endoderm (canal system)	1	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8040400	jellyfish mesoglea cells	jellyfish mesoglea cells	not recorded	not recorded	SRP165275	0.96
SRR8040405	jellyfish mesoglea cells	jellyfish mesoglea cells	not recorded	not recorded	SRP165275	0.00
SRR8040387	complete polyp induced 20h	complete polyp induced 20h	not recorded	not recorded	SRP165275	2.73
SRR8040407	jellyfish canal system endoderm	jellyfish canal system endoderm	not recorded	not recorded	SRP165275	2.40
SRR8089704	mesoglea cells	mesoglea cells	not recorded	not recorded	SRP165275	0.00
SRR8089703	bell edge (ectoderm and canal)	bell edge (ectoderm and canal)	not recorded	not recorded	SRP165275	0.00
SRR8089702	tentacles (distal part)	tentacles (distal part)	not recorded	not recorded	SRP165275	0.00
SRR8089701	planula complete	planula complete	not recorded	not recorded	SRP165275	6.62
SRR8089700	male gonad	male gonad	not recorded	not recorded	SRP165275	3.74
SRR8089699	jellyfish ectoderm (upper bell surface)	jellyfish ectoderm (upper bell surface)	not recorded	not recorded	SRP165275	3.20
SRR8089698	jellyfish ectoderm (muscle layer)	jellyfish ectoderm (muscle layer)	not recorded	not recorded	SRP165275	1.25
SRR8040411	complete juvenile jellyfish ~1cm in diameter	complete juvenile jellyfish ~1cm in diameter	not recorded	not recorded	SRP165275	0.00
SRR8040410	strobila foot	strobila foot	not recorded	not recorded	SRP165275	0.00
SRR8040409	jellyfish ectoderm from the upper side of the bell	jellyfish ectoderm from the upper side of the bell	not recorded	not recorded	SRP165275	12.79
SRR8040408	complete juvenile jellyfish ~2.5cm in diameter	complete juvenile jellyfish ~2.5cm in diameter	not recorded	not recorded	SRP165275	0.00
SRR8040406	jellyfish striated muscle layer	jellyfish striated muscle layer	not recorded	not recorded	SRP165275	2.14
SRR8040388	strobila head	strobila head	not recorded	not recorded	SRP165275	0.00
SRR8040404	jellyfish gastric filaments	jellyfish gastric filaments	not recorded	not recorded	SRP165275	3.29
SRR8040403	jellyfish bell edge	jellyfish bell edge	not recorded	not recorded	SRP165275	0.00
SRR8040402	jellyfish oral arm	jellyfish oral arm	not recorded	not recorded	SRP165275	0.25
SRR8040401	jellyfish bell middle part	jellyfish bell middle part	not recorded	not recorded	SRP165275	2.50
SRR8040399	polyp ectoderm from body column	polyp ectoderm from body column	not recorded	not recorded	SRP165275	10.80
SRR8040398	polyp head region	polyp head region	not recorded	not recorded	SRP165275	0.00
SRR8040397	polyp endoderm from body column	polyp endoderm from body column	not recorded	not recorded	SRP165275	2.76
SRR8040396	strobila non-segmented part	strobila non-segmented part	not recorded	not recorded	SRP165275	0.00
SRR8040395	strobila segments	strobila segments	not recorded	not recorded	SRP165275	0.00
SRR8040390	complete polyp induced 12h	complete polyp induced 12h	not recorded	not recorded	SRP165275	5.05
SRR8040389	complete polyp not induced	complete polyp not induced	not recorded	not recorded	SRP165275	0.00
SRR8089705	endoderm (canal system)	endoderm (canal system)	not recorded	not recorded	SRP165275	0.00

Source: CnidoSite RNA-seq expression matrices (AAURI2_TPM, StringTie quantification over 29 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.