Gene detail

Detailed information of scaffold2139.g1.t1 in Aurelia aurita complex sp. Pacific

Genomic Location: scaffold2139:1614...12274
NR annotation: no NCBI-NR hit recorded
Species Aurelia aurita complex sp. Pacific · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

scaffold2139.g1.t1

attgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgtaagagataattgcatgggtcttttctaccatgggtgactacgatattaaaagaacactgctaataattcatcatcgcaaactatgatttcaaatcatgttcctaacgttggtgacagcggaatcaacatgctacctgaacatgaagctcacttgaacaggattaacaatgcagcagctttctttccaaagaagggtttctccattcttcacctaaatactcgaagtattttccctaaaattgatgaaattcgactgtttgccaaagaaaacccctatcatattcttgcattttctgatacatggttgtcaagctcaatcagcagttctgaaatacaaattctaggttatgctgaccctgttcgatgtgatcgtaagtacaatgatcaggcaggaggaggtttagcagtttacttgaaacaatcagttccccacaaagaaatcacctcgatcagctgccaagatctcgaggctattgctataaaaatcagcccctcaaattctccatcgttcgtacttattgctgtgtataggccatcttcccattcaccccttgagccacaccttactaacttcctggatggtgtctttgaatcttgtccctctatggatgatgttgtcatgctcggtgactttaatcttaaccaactcgaaaggaataattcaactgtgcagatggacaacatctgccttacttatagccttncctcaaattctccatcgttcgtacttattgctgtgtataggccatcttcccattcaccccttgagccacaccttactaacttcctggatggtgtctttgaatcttgtccctctatggatgatgttgtcatgctcggtgactttaatcttaaccaactcgaaaggaataattcaactgtgcagatggacaacatctgccttacttatagccttcagcagcttattgacttgccgactagagtaactgaaacgtcttcaactttgattgatctgatatttgtctctgagcaatcatatgtcttgttatcaggagtcatccctatggctatcagtgatcactttggaatctttttatcaagaactgctaataaatctgggaaaacaaagcaagatcatcttttacatacctatcgtgattttaaagcatttgacgaaaaaaagttccttgaggatgtgaatgcaaccccttggaatttgatggatgtatttaatgacattgatgacaatcgagcatggtttcgggacatttcgtttggtcttataccaagtacttgccgatattttctacaaattgattaaccagttgcttgactgcacctaagcgtgataagcgaatcaggaaagaatcttatccttggataactagtgatgttattgaacatattaggaggaaagcatacgctcagcagttatatctaaaaaacaaaactgatcacacatggaatttctataaatctgctcgaaataaaactacaaacgttattcggcaagctaaaagagaatattttgttgatgcaattgaaagtgctagttatatttaattgattgtcatttttgtctgagtgtggaatttgcgtttggtcagttaacttgttttcaactacttttcgtgaatcttagtatcatcaagttttcaattcctgcttttcttttcataacaatgtcactgcaaaatccatattctttcataattcttgaaacctcttcaggtttatttttgtcaatgacaaccatgtagaagacccctttgtctgataacaacttcacagcagaaggtaggaacctgtctatcacttctctcccatcaatgcctcctgcccaggctgcttcaatggaatgacttccaacttcacttgatggagtcacaacatagggtgggttgaaaataagtatgtctactaaacgatgcaatcttggcattaggctttttgctagatcatcaacaattacagtgatgctggcattgtttattttcccggtttcagttgaacatattgcagcattttgatttagatctgtagctaaatatacactagagctgccaagtaaacttgctaaggatgttgaaacgatgccagaaccaaccccaacctctaaacacactgtaggcccaatttttgtgatcaaactgatgtcagcttctaaggcgtctagcaacaagaaagtgtcttctgcaggctcataaacatcttcagagaatttcttcaaatgtgaataaataggagtctttaaaatatctttccttgcggccatgttctttgaaattgtagtttgatgtgcaattttaatcacactctgttgtgaaagagtgcattcgtaattcggcctcgattggaaagagagtgcaaggccagacttcagcgttagttcaaatgggcctgggcctatacccaaaaaaaataaaagtcaacataacgataccaatagttctagcctgcgcgcagtcttacttaacataatcctaaagagtgtacacttaggattgttgaggcagcacgtaggctaaaattaaaatagtacgtgatgttacattgtcacctacctgaacattgatgtcgcagttgtcgtgacctattttggtttgtttcgatgaaacatcatactgactgccatctaatcttgagatcaaagaagctcgcatttccacctttattctttgcgccctgcatcaagatgaaacggccgattgcaccaataattctaaaatggcgga

Transcript

scaffold2139.g1.t1

ATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGTAAGAGATAATTGCATGGGTCTTTTCTACCATGGGTGACTACGATATTAAAAGAACACTGCTAATAATTCATCATCGCAAACTATGATTTCAAATCATGTTCCTAACGTTGGTGACAGCGGAATCAACATGCTACCTGAACATGAAGCTCACTTGAACAGGATTAACAATGCAGCAGCTTTCTTTCCAAAGAAGGGTTTCTCCATTCTTCACCTAAATACTCGAAGTATTTTCCCTAAAATTGATGAAATTCGACTGTTTGCCAAAGAAAACCCCTATCATATTCTTGCATTTTCTGATACATGGTTGTCAAGCTCAATCAGCAGTTCTGAAATACAAATTCTAGGTTATGCTGACCCTGTTCGATGTGATCGTAAGTACAATGATCAGGCAGGAGGAGGTTTAGCAGTTTACTTGAAACAATCAGTTCCCCACAAAGAAATCACCTCGATCAGCTGCCAAGATCTCGAGGCTATTGCTATAAAAATCAGCCCCTCAAATTCTCCATCGTTCGTACTTATTGCTGTGTATAGGCCATCTTCCCATTCACCCCTTGAGCCACACCTTACTAACTTCCTGGATGGTGTCTTTGAATCTTGTCCCTCTATGGATGATGTTGTCATGCTCGGTGACTTTAATCTTAACCAACTCGAAAGGAATAATTCAACTGTGCAGATGGACAACATCTGCCTTACTTATAGCCTTNCCTCAAATTCTCCATCGTTCGTACTTATTGCTGTGTATAGGCCATCTTCCCATTCACCCCTTGAGCCACACCTTACTAACTTCCTGGATGGTGTCTTTGAATCTTGTCCCTCTATGGATGATGTTGTCATGCTCGGTGACTTTAATCTTAACCAACTCGAAAGGAATAATTCAACTGTGCAGATGGACAACATCTGCCTTACTTATAGCCTTCAGCAGCTTATTGACTTGCCGACTAGAGTAACTGAAACGTCTTCAACTTTGATTGATCTGATATTTGTCTCTGAGCAATCATATGTCTTGTTATCAGGAGTCATCCCTATGGCTATCAGTGATCACTTTGGAATCTTTTTATCAAGAACTGCTAATAAATCTGGGAAAACAAAGCAAGATCATCTTTTACATACCTATCGTGATTTTAAAGCATTTGACGAAAAAAAGTTCCTTGAGGATGTGAATGCAACCCCTTGGAATTTGATGGATGTATTTAATGACATTGATGACAATCGAGCATGGTTTCGGGACATTTCGTTTGGTCTTATACCAAGTACTTGCCGATATTTTCTACAAATTGATTAACCAGTTGCTTGACTGCACCTAAGCGTGATAAGCGAATCAGGAAAGAATCTTATCCTTGGATAACTAGTGATGTTATTGAACATATTAGGAGGAAAGCATACGCTCAGCAGTTATATCTAAAAAACAAAACTGATCACACATGGAATTTCTATAAATCTGCTCGAAATAAAACTACAAACGTTATTCGGCAAGCTAAAAGAGAATATTTTGTTGATGCAATTGAAAGTGCTAGTTATATTTAATTGATTGTCATTTTTGTCTGAGTGTGGAATTTGCGTTTGGTCAGTTAACTTGTTTTCAACTACTTTTCGTGAATCTTAGTATCATCAAGTTTTCAATTCCTGCTTTTCTTTTCATAACAATGTCACTGCAAAATCCATATTCTTTCATAATTCTTGAAACCTCTTCAGGTTTATTTTTGTCAATGACAACCATGTAGAAGACCCCTTTGTCTGATAACAACTTCACAGCAGAAGGTAGGAACCTGTCTATCACTTCTCTCCCATCAATGCCTCCTGCCCAGGCTGCTTCAATGGAATGACTTCCAACTTCACTTGATGGAGTCACAACATAGGGTGGGTTGAAAATAAGTATGTCTACTAAACGATGCAATCTTGGCATTAGGCTTTTTGCTAGATCATCAACAATTACAGTGATGCTGGCATTGTTTATTTTCCCGGTTTCAGTTGAACATATTGCAGCATTTTGATTTAGATCTGTAGCTAAATATACACTAGAGCTGCCAAGTAAACTTGCTAAGGATGTTGAAACGATGCCAGAACCAACCCCAACCTCTAAACACACTGTAGGCCCAATTTTTGTGATCAAACTGATGTCAGCTTCTAAGGCGTCTAGCAACAAGAAAGTGTCTTCTGCAGGCTCATAAACATCTTCAGAGAATTTCTTCAAATGTGAATAAATAGGAGTCTTTAAAATATCTTTCCTTGCGGCCATGTTCTTTGAAATTGTAGTTTGATGTGCAATTTTAATCACACTCTGTTGTGAAAGAGTGCATTCGTAATTCGGCCTCGATTGGAAAGAGAGTGCAAGGCCAGACTTCAGCGTTAGTTCAAATGGGCCTGGGCCTATACCCAAAAAAAATAAAAGTCAACATAACGATACCAATAGTTCTAGCCTGCGCGCAGTCTTACTTAACATAATCCTAAAGAGTGTACACTTAGGATTGTTGAGGCAGCACGTAGGCTAAAATTAAAATAGTACGTGATGTTACATTGTCACCTACCTGAACATTGATGTCGCAGTTGTCGTGACCTATTTTGGTTTGTTTCGATGAAACATCATACTGACTGCCATCTAATCTTGAGATCAAAGAAGCTCGCATTTCCACCTTTATTCTTTGCGCCCTGCATCAAGATGAAACGGCCGATTGCACCAATAATTCTAAAATGGCGGA

Protein

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14529 all species →	Exo_endo_phos_2	Endonuclease-reverse transcriptase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036691 all species →	Homologous_superfamily	Endonuclease/exonuclease/phosphatase superfamily	Interproscan
IPR005135 all species →	Domain	Endonuclease/exonuclease/phosphatase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR33776 all species →	ENDO/EXONUCLEASE/PHOSPHATASE DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for scaffold2139.g1.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of scaffold2139.g1.t1 across 29 RNA-seq samples of Aurelia aurita complex sp. Pacific. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

29Samples

4TPM > 0

28Conditions

4.0Max TPM

0.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
jellyfish mesoglea cells	2	0	0.00	0.00
complete polyp induced 20h	1	0	0.00	0.00
jellyfish canal system endoderm	1	0	0.00	0.00
mesoglea cells	1	0	0.00	0.00
bell edge (ectoderm and canal)	1	0	0.00	0.00
tentacles (distal part)	1	0	0.00	0.00
planula complete	1	0	0.00	0.00
male gonad	1	1	0.10	0.10
jellyfish ectoderm (upper bell surface)	1	0	0.00	0.00
jellyfish ectoderm (muscle layer)	1	0	0.00	0.00
complete juvenile jellyfish ~1cm in diameter	1	0	0.00	0.00
strobila foot	1	0	0.00	0.00
jellyfish ectoderm from the upper side of the bell	1	1	3.47	3.47
complete juvenile jellyfish ~2.5cm in diameter	1	0	0.00	0.00
jellyfish striated muscle layer	1	0	0.00	0.00
strobila head	1	0	0.00	0.00
jellyfish gastric filaments	1	1	4.05	4.05
jellyfish bell edge	1	0	0.00	0.00
jellyfish oral arm	1	0	0.00	0.00
jellyfish bell middle part	1	0	0.00	0.00
polyp ectoderm from body column	1	1	0.20	0.20
polyp head region	1	0	0.00	0.00
polyp endoderm from body column	1	0	0.00	0.00
strobila non-segmented part	1	0	0.00	0.00
strobila segments	1	0	0.00	0.00
complete polyp induced 12h	1	0	0.00	0.00
complete polyp not induced	1	0	0.00	0.00
endoderm (canal system)	1	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR8040400	jellyfish mesoglea cells	jellyfish mesoglea cells	not recorded	not recorded	SRP165275	0.00
SRR8040405	jellyfish mesoglea cells	jellyfish mesoglea cells	not recorded	not recorded	SRP165275	0.00
SRR8040387	complete polyp induced 20h	complete polyp induced 20h	not recorded	not recorded	SRP165275	0.00
SRR8040407	jellyfish canal system endoderm	jellyfish canal system endoderm	not recorded	not recorded	SRP165275	0.00
SRR8089704	mesoglea cells	mesoglea cells	not recorded	not recorded	SRP165275	0.00
SRR8089703	bell edge (ectoderm and canal)	bell edge (ectoderm and canal)	not recorded	not recorded	SRP165275	0.00
SRR8089702	tentacles (distal part)	tentacles (distal part)	not recorded	not recorded	SRP165275	0.00
SRR8089701	planula complete	planula complete	not recorded	not recorded	SRP165275	0.00
SRR8089700	male gonad	male gonad	not recorded	not recorded	SRP165275	0.10
SRR8089699	jellyfish ectoderm (upper bell surface)	jellyfish ectoderm (upper bell surface)	not recorded	not recorded	SRP165275	0.00
SRR8089698	jellyfish ectoderm (muscle layer)	jellyfish ectoderm (muscle layer)	not recorded	not recorded	SRP165275	0.00
SRR8040411	complete juvenile jellyfish ~1cm in diameter	complete juvenile jellyfish ~1cm in diameter	not recorded	not recorded	SRP165275	0.00
SRR8040410	strobila foot	strobila foot	not recorded	not recorded	SRP165275	0.00
SRR8040409	jellyfish ectoderm from the upper side of the bell	jellyfish ectoderm from the upper side of the bell	not recorded	not recorded	SRP165275	3.47
SRR8040408	complete juvenile jellyfish ~2.5cm in diameter	complete juvenile jellyfish ~2.5cm in diameter	not recorded	not recorded	SRP165275	0.00
SRR8040406	jellyfish striated muscle layer	jellyfish striated muscle layer	not recorded	not recorded	SRP165275	0.00
SRR8040388	strobila head	strobila head	not recorded	not recorded	SRP165275	0.00
SRR8040404	jellyfish gastric filaments	jellyfish gastric filaments	not recorded	not recorded	SRP165275	4.05
SRR8040403	jellyfish bell edge	jellyfish bell edge	not recorded	not recorded	SRP165275	0.00
SRR8040402	jellyfish oral arm	jellyfish oral arm	not recorded	not recorded	SRP165275	0.00
SRR8040401	jellyfish bell middle part	jellyfish bell middle part	not recorded	not recorded	SRP165275	0.00
SRR8040399	polyp ectoderm from body column	polyp ectoderm from body column	not recorded	not recorded	SRP165275	0.20
SRR8040398	polyp head region	polyp head region	not recorded	not recorded	SRP165275	0.00
SRR8040397	polyp endoderm from body column	polyp endoderm from body column	not recorded	not recorded	SRP165275	0.00
SRR8040396	strobila non-segmented part	strobila non-segmented part	not recorded	not recorded	SRP165275	0.00
SRR8040395	strobila segments	strobila segments	not recorded	not recorded	SRP165275	0.00
SRR8040390	complete polyp induced 12h	complete polyp induced 12h	not recorded	not recorded	SRP165275	0.00
SRR8040389	complete polyp not induced	complete polyp not induced	not recorded	not recorded	SRP165275	0.00
SRR8089705	endoderm (canal system)	endoderm (canal system)	not recorded	not recorded	SRP165275	0.00

Source: CnidoSite RNA-seq expression matrices (AAURI2_TPM, StringTie quantification over 29 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.