Primers can be designed directly against the sequences annotated in CnidoSite, or against a sequence you paste in. Design is performed by primer3 (version 2.6.1) running on this server — your sequence is not sent to any third-party website. For reference, the primers released with this database were designed with an optimal melting temperature of 60°C (58–62 °C), an optimal primer length of 20 bp (18–24 bp), and a GC content between 40% and 60%, with self-complementarity restricted to limit primer-dimer formation; that parameter set is the CnidoSite published protocol preset below.
Template 1,086 bp · parameter preset CnidoSite published protocol (Tm 60 [58-62] °C, 20 [18-24] bp, GC 40-60%) · 5 primer pairs returned.
| Pair | Left primer (5'→3') | Position | Len | Tm (°C) | GC (%) | Right primer (5'→3') | Position | Len | Tm (°C) | GC (%) | Product (bp) | Penalty |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | GTTAGGCCCTGAGCGGATAC | 180–199 | 20 | 59.966 | 60.000 | CGCGGCTGAGAAGTAGCTTA | 434–453 | 20 | 59.899 | 55.000 | 274 | 0.134 |
| 2 | TAACACGGTGCATGGCAGAT | 224–243 | 20 | 60.036 | 50.000 | CGCGGCTGAGAAGTAGCTTA | 434–453 | 20 | 59.899 | 55.000 | 230 | 0.136 |
| 3 | TAACACGGTGCATGGCAGAT | 224–243 | 20 | 60.036 | 50.000 | CATGCTTAGCGTGGGTTTGG | 465–484 | 20 | 59.829 | 55.000 | 261 | 0.207 |
| 4 | GAGAGAAGCGACTGAAGGGG | 42–61 | 20 | 59.825 | 60.000 | GTATCCGCTCAGGGCCTAAC | 180–199 | 20 | 59.966 | 60.000 | 158 | 0.208 |
| 5 | GAGAGAAGCGACTGAAGGGG | 42–61 | 20 | 59.825 | 60.000 | ATCTGCCATGCACCGTGTTA | 224–243 | 20 | 60.036 | 50.000 | 202 | 0.210 |
Left primer — binds the template strand as listed (5′→3′)Right primer — its reverse complement binds hereProduct
Amplicon sequence (5′→3′ on the template strand, 274 bp) — blue is the left primer, red is where the right primer anneals. Copy from here to order or to check a base by eye.
The right primer is listed as its own 5'→3' sequence; what anneals to the template strand shown here is its reverse complement, so the highlighted stretch is complementary to the listed sequence. That is expected.
How to read this table. Position is a 1-based interval on the template, and both primers use the same convention: it is the stretch the primer occupies on the template strand (for the left primer, starting at its 5’ end; for the right primer, the region it anneals to, i.e. where the reverse complement of the listed sequence sits on the template). The two coordinates in a row can therefore be subtracted directly, and the amplicon view above marks both of them so you can check them by eye. Penalty is primer3’s weighted sum of the deviations from your constraints — lower is better, and the pairs are returned in that order. Tm is computed by primer3 from the SantaLucia thermodynamic parameters at the salt and primer concentrations in effect. The primer sequences themselves are 5’→3′ and can be ordered as they stand; the right primer anneals to the template as its reverse complement.
Specificity has not been assessed. This page only designs primers; it does not check whether they also anneal elsewhere in the genome or transcriptome. Once you have candidates, confirm each primer sequence with this site’s BLAST. The Tm and GC settings above are the design targets, and the annealing temperature still has to be optimised at the bench.