Primer Design

Primers can be designed directly against the sequences annotated in CnidoSite, or against a sequence you paste in. Design is performed by primer3 (version 2.6.1) running on this server — your sequence is not sent to any third-party website. For reference, the primers released with this database were designed with an optimal melting temperature of 60°C (58–62 °C), an optimal primer length of 20 bp (18–24 bp), and a GC content between 40% and 60%, with self-complementarity restricted to limit primer-dimer formation; that parameter set is the CnidoSite published protocol preset below.

Template taken from CnidoSite: amic_s0331.g12.t1 (amic_s0331.g12.t1), 493 bp.
Template

Two ways to supply a template: pick a species and a gene / transcript ID, or paste your own sequence. If the gene ID is found it is used; the pasted sequence is used otherwise. A template must be at least 30 bp.

Load example sequence
Primer parameters
Advanced parameters (any field left empty keeps the preset value)

A value that is not a number is ignored. The product size range is applied only when both of its fields are filled in and the maximum is at least the minimum.

Melting temperature
Primer length and GC content
Product and output
Self-complementarity and probe
Download TSV
Design results sorted by primer3 penalty, lowest first

Template 493 bp · parameter preset CnidoSite published protocol (Tm 60 [58-62] °C, 20 [18-24] bp, GC 40-60%) · 5 primer pairs returned.

Pair Left primer (5'→3') Position Len Tm (°C) GC (%) Right primer (5'→3') Position Len Tm (°C) GC (%) Product (bp) Penalty
1 CAAAAACCGAGACCAAGGCG 24–43 20 60.040 55.000 TCTGCTTTCTGTTTTGCGGC 117–136 20 59.969 50.000 113 0.071
2 GCCGCAAAACAGAAAGCAGA 117–136 20 59.969 50.000 CAACTTCGGCTTGCTGTGTC 275–294 20 60.041 55.000 178 0.072
3 CAAAAACCGAGACCAAGGCG 24–43 20 60.040 55.000 CTGCTTTCTGTTTTGCGGCT 116–135 20 59.969 50.000 112 0.072
4 AGCCGCAAAACAGAAAGCAG 116–135 20 59.969 50.000 CAACTTCGGCTTGCTGTGTC 275–294 20 60.041 55.000 179 0.072
5 CAAAAACCGAGACCAAGGCG 24–43 20 60.040 55.000 CAACTTCGGCTTGCTGTGTC 275–294 20 60.041 55.000 271 0.081
Primer map pair 1 (lowest penalty) · product 113 bp at template position 24–136 · the two tracks are drawn at different scales

Left primer — binds the template strand as listed (5′→3′)Right primer — its reverse complement binds hereProduct

Template493 bpproduct 113 bp · template 24–136product 113 bpleft primer, template 24–43right primer anneals here, template 117–1361124247370493Amplicon113 bpleft primer CAAAAACCGAGACCAAGGCG · 5′→3′right primer TCTGCTTTCTGTTTTGCGGC · its reverse complement binds the template strandCAAAAACCGAGACCAAGGCGTCTGCTTTCTGTTTTGCGGCinterior 73 bp245280108136
Left primer
CAAAAACCGAGACCAAGGCG
template 24–43 · 20 bp · Tm 60.040 °C · GC 55.000 %
Right primer
TCTGCTTTCTGTTTTGCGGC
template 117–136 · 20 bp · Tm 59.969 °C · GC 50.000 %

Amplicon sequence (5′→3′ on the template strand, 113 bp) — blue is the left primer, red is where the right primer anneals. Copy from here to order or to check a base by eye.

CAAAAACCGAGACCAAGGCGAAGATTATCAAATACTCCCAAATTTGTGGAGGAGACCAGTTATTTCAAAATGCTAAGGGAAACAAAGGAGAAAGCCGCAAAACAGAAAGCAGA

The right primer is listed as its own 5'→3' sequence; what anneals to the template strand shown here is its reverse complement, so the highlighted stretch is complementary to the listed sequence. That is expected.

How to read this table. Position is a 1-based interval on the template, and both primers use the same convention: it is the stretch the primer occupies on the template strand (for the left primer, starting at its 5’ end; for the right primer, the region it anneals to, i.e. where the reverse complement of the listed sequence sits on the template). The two coordinates in a row can therefore be subtracted directly, and the amplicon view above marks both of them so you can check them by eye. Penalty is primer3’s weighted sum of the deviations from your constraints — lower is better, and the pairs are returned in that order. Tm is computed by primer3 from the SantaLucia thermodynamic parameters at the salt and primer concentrations in effect. The primer sequences themselves are 5’→3′ and can be ordered as they stand; the right primer anneals to the template as its reverse complement.

Specificity has not been assessed. This page only designs primers; it does not check whether they also anneal elsewhere in the genome or transcriptome. Once you have candidates, confirm each primer sequence with this site’s BLAST. The Tm and GC settings above are the design targets, and the annealing temperature still has to be optimised at the bench.

TOP