Gene detail

Detailed information of HOLI00001.G49942 in Hydra oligactis

Genomic Location: HOLI00001:1154681...1157731
NR annotation: WP_262130524.1, MULTISPECIES: formate dehydrogenase-N subunit alpha [unclassified Pseudomonas]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g49942.t1

ATGGGACTGGGTAGACGACAGTTCTTCAAACTGTGCACCGTGGGCGCTGCCACCGCGACCTGCGCCACCCTGGGCTTCGCCCCCGGCATGGCCCAGGCCACCCAGTCTCGCCAGTACAAGCTGCTGCGGGCCAAGGAAACCCGCAACAACTGCACCTACTGCTCGGTGGGCTGCGGCCTGCTGATGTACAGCCTCGGTGACGGCGCGAAAAACGCCAAGGCGCGGATCTTCCATATCGAAGGCGACCCGGATCATCCGGTCAGCCGTGGCTCGCTGTGCCCGAAAGGCGCGGGCCTGGTCGACTACATCCACAGCGACCAGCGTCTGCTGTACCCCGAGTACCGCGCGCCGGGTTCGGACAAGTGGCAGCGAGTGACCTGGGACTACGCCATCGAGCGTATCGCGCGCCTGATGAAGGACGACCGCGACGCCAACTTCATCGAGAAGAACGCCAAGGGCACCACGGTCAACCGCTGGTTGAGCACCGGCATGCTCTGTTCTTCGGCTGCCAGCAGTGAAACCGGCTCGCTCGACCAGCGCTTCACCCGCGCCCTGGGCATCCTCGCCACCGACAGCCAGGCCCGGGTCTGCCACGCCCCCACCGTTTCGGCGCTGGCGCCGACCTTCGGCCGCGGTGCGATGACCAACAACTGGGTCGACATCAAGAACGCCAACGTCGTCCTGATCATGGGCGGCAACCCCGCCGAAGCGCACCCGGTGGGCTTCAAGTGGGTGATCGAGGCGAAGATCCGCAACGGTGCCAAGGTGATCGTGGTCGACCCACGCTTCAACCGCAGCGCAGCAGTGGCGGACATCTACGCACCGATCCGCGCCGGCTCAGACGTGACCTTCCTGATGGGCATGGTCAATTACCTGATCAGCCACGACAAGATCCAGCACGAGTACGTGCGCGCCTACACCAACTCCAGCCTGATCGTGCGCGAGGACTATCACTTCGACGACGGTCTGTTCAGCGGCTACGACGCCGGCAAGCGCAGCTATGACCGCGCTTCGTGGAACTACGAACTGGACGAGAACGGCTTTGCCAAACGCGACCTGACCCTGAGCCACCCGCGCTGCGTGTGGAACCTGCTCAAGGCCCACGTTGCCCGCTACACCCCGGAAATGGTCAGCAACGTCTGCGGCACCTCGCAGGAAGACTTCCTCAAGATCTGCGAGATCCTTGGCGAAACCAGCGCCCCGGACAAAACCGCGACCTTCCTCTACGCCCTCGGCTGGACCCACCACACCAATGGCGCCCAGATGATCCGCGGCTCCGGCATGATCCAGTTGCTGCTCGGCAACATCGGCATGGCCGGTGGCGGCGTCAACGCCCTGCGCGGTCACTCCAACATCCAGGGCTACACCGACCTCGGCCTGCTCTCGCTGCGCCTGCCCGGCTACATGAACCTGCCGTCCGACGCGCAGACCGACCTGGCCACCTACCTCAAGCAGACCACGCCGAGCGCGGTGCTGCCCGACCAGGTCAACTACTACAAGAACACACCGAAATTCTTCGTCAGCATGATGAAGAGCTTCTGGGGCGACAAAGCCACCAAGGACAACGACTGGGGCTTCGAATGGCTGCCCAAGTGGGACGACAGCTATGACGTGATCAACGTCGCCAACCGCATGTACGAAGGCAAGATGAACGGCTACATCGCCCAGGGTTTCAACCCGGTGGCGGCGTTCCCAGACAAGAACAAGGCCCAGGAAGCACTGGCCAAGCTGAAGTTCCTGGTGATCATCGACCCGCTGGCCACCGAGACCTCGAGCTTCTGGAAGAACCACGGCGAAGAGCACAACGTCGACACCGCGTCGATCCAGACCGAAGTGTTCCGCCTGCCCTCCTCCTGCTTCGCCGAAGAAGACGGCTCGATCGTCAACTCCTCGCGCTGGCTGCAATGGCACTGGGCCGGCGCGGCGCCACCCGGCGAGGCCTGGCACGACGGCAAGATCCTCGGCCACCTGTTCATGAAGCTGCGCGAGCTGTACGCAAAGGAAGGCGGTGCCAACCCTGCGCCAGTGCTCAACATGGCCTGGGACTACGCCGACCCGCACGACCCCAAACCCGAAGAAGTGGCCAAGGAATCCAATGGCCGGGCACTGGCTGACCTGCTCGACGACAAGGGCAACCTGATCCTGCGCAAGGGGCAGTTGCTCAACGACTTCGGCCAACTGCGCGATGACGGCAGCACCGTCTGCTTCAACTGGATCTTCGCCGGTTCCTGGACCGAGCAAGGCAACCAGATGGCCCGTCGCGACAACACCGACAGCGGCCTGGGCAACACCCCTGGCTGGGCCTGGGCCTGGCCGCAGAACCGCCGCGTGCTGTACAACCGCGCCTCGGCCGACCCGGCCGGCAACCCGTGGGATCCGAAGCGCAAGCTGATTGGCTGGGACGGCGTGCGCTGGAGCGGCGTCGACGTGCCGGACTTCGCCCCGACCATCGCGCCGGGCACCGCCACCTGCCCGTTCATCATGCTGCCGGAAGGCGTGGGCCGGCTGTTCTCGGTGGGCGCGCTCAACGACGGGCCGTTCCCCGAGCACTACGAGCCGACCGAAAGCCCGCTGGCCAGCAACCCGCTGCACCCGGCCGTGACCTACAGCCCGACCGCCCGGCTGTACGACCACGACCGCTCACGGATGGGCAAGCGCGAGGAGTTCCCTTACGTCGCCACTACCTATTCGATCACCGAGCTGTTCCGTCACTGGACCAAGCACGCCCGGCTCAACGCCATCGTCCAGCCCGAGCAGTTCGTCGAGATCGGCGAAAAACTGGCGGCCGACAAGGGCATCAAGCAGGGCGACCGGGTCAAGGTCAGCACCAAGCGCGGCTACATCAAGGCCAAGGCCGTGGTGACCAAGCGCATCCAGCGCCTGACCATCGACGGCCAGCAGGTGGACACCATCGGCATTCCTTGCCACTGGGGCTATGAAGGCACCTCGCGCAAGGGCTTCCTGGCCAACACCCTGACTCCTGGCGTCGGCGACTCCAACACCCATACGCCGGAATACAAGGCGTTTCTCGTCAACGTGGAAAAGGTCTGA

Transcript

HOLI00001.g49942.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P32176	Formate dehydrogenase-O major subunit OS=Escherichia coli (strain K12) OX=83333 GN=fdoG PE=1 SV=5
P24183	Formate dehydrogenase, nitrate-inducible, major subunit OS=Escherichia coli (strain K12) OX=83333 GN=fdnG PE=1 SV=3
P46448	Formate dehydrogenase major subunit OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) OX=71421 GN=fdxG PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0018557 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00384 all species →	Molybdopterin	Molybdopterin oxidoreductase	Family	Interproscan
PF01568 all species →	Molydop_binding	Molydopterin dinucleotide binding domain	Domain	Interproscan
PF04879 all species →	Molybdop_Fe4S4	Molybdopterin oxidoreductase Fe4S4 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006656 all species →	Domain	Molybdopterin oxidoreductase	Interproscan
IPR006443 all species →	Family	Formate dehydrogenase-N, alpha subunit	Interproscan
IPR006657 all species →	Domain	Molybdopterin dinucleotide-binding domain	Interproscan
IPR006963 all species →	Domain	Molybdopterin oxidoreductase, 4Fe-4S domain	Interproscan
IPR027467 all species →	Binding_site	Molybdopterin oxidoreductase, molybdopterin cofactor binding site	Interproscan
IPR009010 all species →	Homologous_superfamily	Aspartate decarboxylase-like domain superfamily	Interproscan
IPR006311 all species →	Conserved_site	Twin-arginine translocation pathway, signal sequence	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43598 all species →	TUNGSTEN-CONTAINING FORMYLMETHANOFURAN DEHYDROGENASE 2 SUBUNIT B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0009055 all species →	Molecular Function	electron transfer activity	Interproscan
GO:0009061 all species →	Biological Process	anaerobic respiration	Interproscan
GO:0030151 all species →	Molecular Function	molybdenum ion binding	Interproscan
GO:0008863 all species →	Molecular Function	formate dehydrogenase (NAD+) activity	Interproscan
GO:0043546 all species →	Molecular Function	molybdopterin cofactor binding	Interproscan
GO:0045333 all species →	Biological Process	cellular respiration	Interproscan
GO:0047111 all species →	Molecular Function	formate dehydrogenase (cytochrome-c-553) activity	Interproscan
GO:0051539 all species →	Molecular Function	4 iron, 4 sulfur cluster binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08348	fdnG; formate dehydrogenase-N, alpha subunit	EC:1.17.5.3	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →