Gene detail

Detailed information of HOLI00001.G50053 in Hydra oligactis

Genomic Location: HOLI00001:1293249...1296754
NR annotation: TEE71756.1, LysR family transcriptional regulator [Pseudomonas aeruginosa]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g50053.t1

ATGCCATTCTGCACGATGGTGCCAGAAGTGCAGGGCTTCATTGCTGCACAGTGCGCAGCAATGAACTGCAATCCGGCTATCTTGTTGCTCGATACGCTGGTTCCCATACTGCGCCCACACTCAACGGACGCCCCACGGGCGAGGAGAACGGCAATGGCCACAGCAGTGCGTTTCAGTCAGGCAGGCGGCCCGCAGGTACTTGAACTTGTGCAGGTGGAAGACGTTGCGCCCGGACCGGGTGAGGTGTGGCTGGAGCACGAAGCCATCGGCGTGAACTATCTCGATGTCAGCCAGCGCAAAGGCGGGGTGGCGCTGGCGTTGCCCAGCGGCCTTGGCCTCGAAGGTGCAGGCCGCGTCGTGCGCCTCGGCGATGGCGTGAGCAATGTCGCCGTGGGCGATCGGGTCGCCTACGCCACCGGGCCGCTGGGCGCCTACGCCGATGCGCGTTCGTTTCCCGCCGAGCGCCTGGTGAAACTGCCCGCCGGGTTGACCTGCGAGGACGCCGCCGCCGTGCTGTTCAAGGGCATCACCGCGCAGTACCTGCTCAAGTCGACGTACCCGGTCGGCCCCGGCACGACCTTGCTGCTGTACGGCGTTGCCGGTGGGCTCGGATCGCTCATGGCGCAGTGGGCCAAGCACCTCGGGGCCTTCGTGATCGGCGTGGTATCGCGGCCGGCCAGCGTGGAAAAGGCCAGGGCGCTGGGCTGCGACGCGGTGCTGGTGTTCGACCCGCTGACACTGGCGGCAGAAGTGTCGCGCATCACCGAAGGGCGCAAGGTGGATGTGGTCTACGACCCGATCGGCCGTATTTCTTTCGAGGCGTCTCTGGACAGCCTGCGGCCGCGCGGGCTCATGGTGTCGTTCGGCGCATCATCCGGTGCCCCGGCAGCGCTGGAGATGGCCACGCTGAACAGCAAGGGCTCGCTGTTCATCACCCGGCCTTCGCTGGCGGCACATACCGCTACCGTGGCGGAGTATCAGCAGCGTGCCGCTGACGTGCTGGCGGCACTTGCCGCAGCCATGAGTGCAGACATGCTCGACAACGCTCACAGCGATGAAATCGCCGCCTTCCTCGCGGTCGCCGCGCAGGGCTCCTTCGTCGCTGCCGGGCGCTTTCTGGAGCGCCATCCCACGGTGATCTCCAAGCGTGTGGCAGCGATGGAAAAGCGTCTGGGCGTGCGCCTGATCGAACGCTCCACGCGGCAGGTGCGCATCACTACCGTTGGGGAAAAACTGCAACAGCGCCTGCGCGCGGCGCTGGATATGATCGCCGAAGCCGAGCAGCAGGCCATCTCCGGCGCCGCCGAAATTCGCGGGGTGCTGCGCCTGGCCCTGCCGGCGGCAATGGGGCGGCTGTGCATCGGCCCGTTGCTGGCGGACTTTCTGCAGCAATACCCGCAGGTGTCGATCGTCGCCGACTACAGCGAACGGCTGGTGGACATCATCGAGGAAGGTTTCGATATCGCCATCCGCATCGGCGAGCTGGAAGATAACCGCCTGATCGCGAAAAAACTCTGCGACCACCGGCGCATTCTCTGCGCCTCTCCCGGTTACCTTGAACGCCACGGCACACCGACCACGCCGCAGCAGCTTGGCGAGCACAACTGCCTGAGGTTCAGCGGGCTGGCGTCGTTTCCGCAATGGCGGCTGTATGCCGAGGGCCGGCAGCACACGCTGGCGCCCAAGGGCAACCTGACCGCCAACGACAGCGAATCGCTGCTGGCCGCCGCCCGCAGCGACGCCGGCATCCTCGGTGCAGGGGAGTGGCTGATGAGTCGCGACATTGCTGCCGGGCGCCTGGTGCGGGTACTGCCGGAGTGGCAACTGGACCCCACCGGTGGCGTGTTCCTGGTGCGGCCCTCGGCGCGCTTTCCGGCGGCTGCGGTGCTGGCCTTCAAGCAGTGGATCGAGTCGCGCTTCACCCCGGCACCACCGTGGGTCGAGGTCATCGTGCAGGCCGATCCCCCGAAACCCTCGCTGTTGTCCACGCTGGTTCGTCACTATGACGAACTGGTGGAGCACGTTCGCCGCCGTTTTGGCGAGCGCGGCTTTGCCCGCGAAGTGGTGCACGACGTTTGCGTGCAGTTGCTCGAAAAGCACGAGAAGGACGGCGTGCGCACGCCGCTGGCGCTGCTGCGCAAGATCACCCACGACAACGCGGCCAGCCGCTACCGTGGTGAGCGCCGGCGCCAGGCGTGGATCGTCGCGGTGCCGGAGCTCCCCGAAGTGGACGCCGGGATCGCCAGCCAGGAACGCCAGCTCGACGCCGCCAAGGCGCTGGACCGTCTGGTCCGCGCCATCGAAGGCCTGCCACCGCGTTGCCAGATGGTTTTCGTGATGCACAAGATTCATGAACTGCCTCAGGCCGAGGTCGCTGCGCGTCTGGGCATCTCCCTGAAAACCGTGGAAAAGCACCTGCGCCTGGGCATGGCGGCCTGCCGCGAGTATCTCGGCGATGAGGCCATCGCCCGCCTGCGCGAGGAACTCAAGCAGCGTTTCCCATTGCCCGAGCCGCCACCGCCGCGCAAGAAACGCAGCGGCGCCAGCGCGGTCGGCCTGCTGTCGCTGGCGCTGCTGGCGGCGCTGGTCTGGCTCGACCCGGCGTACCACAGCAGCCATTACCTGAGCACAACCGGCCAGCGCCAGACCCTGCATCTGGCCGATGGCAGCCAGGTGGTGCTCGACGGCGCCAGCGAACTGAACGTCAGTTGGCACCTGCGCAGTCGCCGCAGCGAACTGGTTCACGGCCAGGCGCTGTTCGAGGTGTCGGCGAAAATCTACCGGCCGTTCCTGGTGGACGCCGGTACAGCGGCGGTGAAAGTGGTGGGCACCCGCTTCAATGTCAGCCGCGAACGCGATGACGTCCGGGTGACGGTCGCCGAGGGCCGGGTCGCCGTGCAGGCTGACAACGCTTCCAGCCTGCTCGGTGCCGGTCAGCAAGTGCAAGTCCACGCCGGTCAATTGGGTGCAACGGCATCTGTGGACGCGGCCGCCGTCATGGCCTGGCGCAGCGGCCAGTTGGTTTTCGAAAGCACGCCGCTGGCCGAGGTGGTCACGGTGATCCAGCGCTACCACGCCAAACCGATACGCCTGAGTGACCCGACGCTGGGCAGCCTGCCGGTTTCCGGGGTGTTCGACAGCGCCCAGGTCGAGCGGCTGCTGACGTTGCTGCCGGGCATTCTGCCGCTGACGGTCAGCACGACTGCCGACGGTTCGGTGCTGATTGGCGCCCGCGGGAAAAAATAA

Transcript

HOLI00001.g50053.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P43903	Quinone oxidoreductase OS=Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) OX=208964 GN=qor PE=3 SV=2
P28304	Quinone oxidoreductase 1 OS=Escherichia coli (strain K12) OX=83333 GN=qorA PE=1 SV=1
P40783	Quinone oxidoreductase OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=qor PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0013289 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00107 all species →	ADH_zinc_N	Zinc-binding dehydrogenase	Domain	Interproscan
PF03466 all species →	LysR_substrate	LysR substrate binding domain	Family	Interproscan
PF04773 all species →	FecR	FecR protein	Family	Interproscan
PF00126 all species →	HTH_1	Bacterial regulatory helix-turn-helix protein, lysR family	Domain	Interproscan
PF08281 all species →	Sigma70_r4_2	Sigma-70, region 4	Domain	Interproscan
PF08240 all species →	ADH_N	Alcohol dehydrogenase GroES-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013149 all species →	Domain	Alcohol dehydrogenase-like, C-terminal	Interproscan
IPR011032 all species →	Homologous_superfamily	GroES-like superfamily	Interproscan
IPR000847 all species →	Domain	Transcription regulator HTH, LysR	Interproscan
IPR013324 all species →	Homologous_superfamily	RNA polymerase sigma factor, region 3/4-like	Interproscan
IPR005119 all species →	Domain	LysR, substrate-binding	Interproscan
IPR006860 all species →	Domain	FecR protein	Interproscan
IPR013325 all species →	Homologous_superfamily	RNA polymerase sigma factor, region 2	Interproscan
IPR020843 all species →	Domain	Polyketide synthase, enoylreductase domain	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR047618 all species →	Family	Quinone oxidoreductase-like	Interproscan
IPR013249 all species →	Domain	RNA polymerase sigma factor 70, region 4 type 2	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR014284 all species →	Domain	RNA polymerase sigma-70 like domain	Interproscan
IPR013154 all species →	Domain	Alcohol dehydrogenase-like, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30537 all species →	HTH-TYPE TRANSCRIPTIONAL REGULATOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0006352 all species →	Biological Process	DNA-templated transcription initiation	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0006351 all species →	Biological Process	DNA-templated transcription	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0003960 all species →	Molecular Function	NADPH:quinone reductase activity	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0016987 all species →	Molecular Function	sigma factor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00001.G50053.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →