Gene detail

Detailed information of HOLI00001.G50505 in Hydra oligactis

Genomic Location: HOLI00001:1902261...1905147
NR annotation: WP_262156151.1, MULTISPECIES: sigma-54 dependent transcriptional regulator [unclassified Pseudomonas]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g50505.t1

ATGGTGGTGAACAGCGATGAAACGGCCATTGCCGGCCAGGCCAACGCCATGCTTGCCCGTTCCCGGCGGCCATTCGACCTGCTGCGCTGGTTTTCCCTGGTCAGCCTGCTGATCATCGCCTCTGTCGCGGCCCTGCTCGGCTATGTCTCGACCCGCTTCGTGGTCAATGACAGCGTCGAGCGCGATGCAATGCTCACCGCCCAGTTCATCCAGGCCATGGCCAAGGCCGAAGTGCGCCACGCGCGGATACCGGAAACGGTGACCATGGGCGAACTGCTCGACCCGCGCCTGGACGGCCAGCATCCGGGCCTCGCCGCCACGGTGGTGGCCGATGCGCGGATCGAGTTCCTCGATCATGTCGAACACCTGCCCGACACCTTGCTGGCCAACGTCTATGCCCTGGACCGAAGCATTGTCTGGTCGACCAATCCCGCGCTGATCGGCCGCAAGATCGAGGGCGACCATGATCTGGAAGAGTCCTTCGCCTCCCGCGTGCCGGTCTCGGCCAGCTACCACAAGGCCGCCGACGAGCGTGAAGAGCAGCAGTTCCAGCGCGAGCCGCGCTACCTGTTCATCGAGAACTACATCCCGATGTTCGATGCGGCGGGCAGCAAGGTGGTGTCGATGGTCGAGGTGTACAAGGAGCCGCAGGACCTGGTCCGGCGCATTCAGCGTGGCTACGTGCTGATCTGGAGCAGCAGCATCATCGGCGGCCTGCTGGTGTACCTGGGGCTGTTCTGGATCGTCCGCCGTGGTGCGCGCATGCTCGCTTCACAGCAACGCCGCCTGGTCGCCAGTGAAACCTTTGCCGCGCTGGGGGAGATGTCCTCAGCGGTGGCCCACAGCCTGCGCAATCCACTGGCGACCATCCGCTCCAGCGCCGAACTGGCCCATGAAGTGGCCAGCGCACCGGCACAACAGAACATCACCGACATCATCAGCCAGGTCGACCGCATGTCGCGCTGGGTCCGCGAACTGTTGGTGTCGTTGCGACCGGCCAGCGACGAGGCCGAGGACGTCGACCTGCTGGCCGCGCTGGATGACGCTCGCAGCACTTTCGCCGGACAGATCGCCCGCTGCCGGGTCGAGGTACAGGTCAGCACGCCGCCTGCAGCCAGCGTATCTAGCCAGCCGCTGCTGCTCGCGCAGATCCTCAACAGCCTGTTCGCCAATGCGCTGGAAGCCATGCCCGACGGTGGCCGGCTGAGCATCGAGGTGACGGCACAGGAGGGCGGCCAACAGTGGCGCCTGGACCTGCGCGACAGCGGCAAGGGCATGAGCCGGCAGCAGGAACTGATGGTGTTCAAACCGTTTTTCACCACCAAGCAGGGCGGCCTCGGGGTTGGCCTGGTGCTGGTCAAGCGCATCATGGAACGATTTGGCGGTTCGGTCCGATTGACCAGCCGTGAGGAGGAAGGAACCCGTACCTACCTCGAGCGCAAGCAGTTCGAGGTCACGGTCTGCCACAGCGCCGAAGACGCCCTGGAGCAGTTGCAGCACATCCAGCCGGACGCGGTGTTGACCGACAACTCGCTGCCGGGAATGAACGGCCACGAACTGCTCAAGACCCTGGTCAAGCAGGCGCCGGAACTGAAGGTCATCATGATGACCGGCTATGGCAACGTCGAAGACGCGGTGACGGCGATGAAAGAGGGCGCCTTTCACTACCTGACCAAGCCGGTGGCGCTGGCCGAGCTGAAACTGATGCTGGACAAGGCCCTGGCCACCGAACGGCTGGAGCGCACATTGTCGTTCTACCAGGAACGCGAGGCGTCGAAGTCGGGCATCCAGGCACTGATCGGCGAGTCGCCGGCCATGCTCGGGCTCAAGCACACCCTGCAGCAATTGCTCGACGCCGAGCAGCGCATGACCAGTGGTGACCTGCCGCCGGTGCTGGTGGAGGGCGAGACCGGTACCGGCAAGGAACTGGTGGCCCGCGCCCTGCATTTCGACGGGTCGCGGAGCAAGGCGCCGTTCATCGAATTCAACTGTGCGTCGATTCCGGCCAACCTGCTCGAAGCCGAGCTGTTCGGCCACGAAAAGGGCGCGTTCACCGATGCCAAGGACCGTCGGGTCGGGCTGGTCGAGGCCGCCGATGGCGGTACCTTGTTCCTCGACGAAATCGGCGAAATGGACCTGCTGCTGCAGGCCAAGCTGTTGAAGCTGCTGGAAGACCGCACCATTCGCCGGATCGGCGCGGTCAAGGAGCGCAAGGTCAACCTGCGCATCATCAGCGCCACCAACTGCAACCTCGAGCAGATGGTGCAGCAGGGCAAGTTTCGCCGTGACCTGTTCTTTCGCCTGCGCATCATCTCGATCAAGGTGCCGCGTCTGTATGCCCGGGGTGAAGACATCCTGTTGCTGGCCCGGCATTTCCTTGCCCAGCACGCCCGGCGCTATGGCAAGGGCACGCTGCGCTTCAGCGCCGAGGCCGAAGACTTGCTGCTCAATTACAGTTGGCCGGGCAACGTGCGGGAACTGCGCAACATGCTGGAGCAGACGGTATTGCTGGCGGGCAGCGAGGTGATTGCGCCGCAGCAGTTGAATGTCTGCGCGAGCCTGGTCGACGAGCCGCTGGCGATGCCTTCGGCGCCGGTGTTCGATGCACGGCCGGTGGCTGATCCGCTGGAGTCGATGAATCTGCCGGAAGTCGAGCGCGACATGGTGCGCAAGATGCTTGACCGAACGGACTGGAATGTCACCAAGTCCGCGCGGTTGCTGGGTTTGAGCCGGGACATGCTGCGTTACCGGATCGAGAAACTGGGGTTGACCCGGCCGGACAAGAAGCAATGGTGA

Transcript

HOLI00001.g50505.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9APD9	Transcriptional regulatory protein ZraR OS=Klebsiella oxytoca OX=571 GN=zraR PE=3 SV=1
Q06065	Regulatory protein AtoC OS=Escherichia coli (strain K12) OX=83333 GN=atoC PE=1 SV=2
P14375	Transcriptional regulatory protein ZraR OS=Escherichia coli (strain K12) OX=83333 GN=zraR PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006783 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02954 all species →	HTH_8	Bacterial regulatory protein, Fis family	Domain	Interproscan
PF00072 all species →	Response_reg	Response regulator receiver domain	Domain	Interproscan
PF00512 all species →	HisKA	His Kinase A (phospho-acceptor) domain	Domain	Interproscan
PF00158 all species →	Sigma54_activat	Sigma-54 interaction domain	Domain	Interproscan
PF02518 all species →	HATPase_c	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025944 all species →	Conserved_site	Sigma-54 interaction domain, conserved site	Interproscan
IPR002197 all species →	Domain	DNA binding HTH domain, Fis-type	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR004358 all species →	Domain	Signal transduction histidine kinase-related protein, C-terminal	Interproscan
IPR001789 all species →	Domain	Signal transduction response regulator, receiver domain	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR003661 all species →	Domain	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR025662 all species →	Binding_site	Sigma-54 interaction domain, ATP-binding site 1	Interproscan
IPR025943 all species →	Binding_site	Sigma-54 interaction domain, ATP-binding site 2	Interproscan
IPR011006 all species →	Homologous_superfamily	CheY-like superfamily	Interproscan
IPR002078 all species →	Domain	RNA polymerase sigma factor 54 interaction domain	Interproscan
IPR003594 all species →	Domain	Histidine kinase/HSP90-like ATPase	Interproscan
IPR036890 all species →	Homologous_superfamily	Histidine kinase/HSP90-like ATPase superfamily	Interproscan
IPR036097 all species →	Homologous_superfamily	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain superfamily	Interproscan
IPR005467 all species →	Domain	Histidine kinase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32071 all species →	TRANSCRIPTIONAL REGULATORY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0016310 all species →	Biological Process	phosphorylation	Interproscan
GO:0016772 all species →	Molecular Function	transferase activity, transferring phosphorus-containing groups	Interproscan
GO:0000160 all species →	Biological Process	phosphorelay signal transduction system	Interproscan
GO:0000155 all species →	Molecular Function	phosphorelay sensor kinase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0008134 all species →	Molecular Function	transcription factor binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00001.G50505.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →