Gene detail

Detailed information of HOLI00001.G51730 in Hydra oligactis

Genomic Location: HOLI00001:3487797...3490369
NR annotation: WP_262128262.1, TonB-dependent receptor [Pseudomonas sp. 5P_5.1_Bac1]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g51730.t1

ATGTTTCGTGCGTTTCGTGCTTCCAAGCCGTTGTCTGCCCGTCCATCGCTGCTTGCCGTGTGCCTGGCCATGAGCCTGCAGGCCCAGGCCGCGCCGGTTGAGCTGCACCTGCCGGCCCAGCCGCTGGCGACCTCGCTGAGCCAGGTGGCGCAGCAGGCCAAGGTGCAATTGCTGTTCGACGAGTCGCTGCTGCGCAATGTCGCCGCGCCCGCCCTCGACGGCCAGTACGAAACCGAGGACGCCATCACCCGTCTGCTCGCCAACAGCCGCTTCGCCCTGGTCAAGGTCGGCAACACCTTCGTGGTGCGTCCCAGGGAAAGCGACACCACTCCACCCGGCAACAACAACACCGCCCTCCAGCTCGGTGCCATGAGCATCGTCGGCAACGGCCAGCAGGTCACTCCGGCCACCGTCGGCCGCTCGACCCTGACCCAGCGCGACATCGACCGCGAACAGGCGAACAACGTGCCGTCCCTGCTCAGCACCCTGCCCGGCGTGGAGATGGCCGGTTCGATGATGCCCGGCGGGCAGAAGATCAATATCTGGGGCATGGGCGACGCCGAGGACGTGCAACTGACCGTCGACGGTGCCACCAAGACCGGCTTCGAGCGCTATCAGCAAGGCACGATGTTCATCGAGCCGGAACTGATCAAGCACATCGAAGTGGAGAAAGGCCCGCACTCGCCCTTCGTCGGCAACACCGGCCTCGGCGGCAGCGTGAACATGACCACCAAGGACGCCCCCGACCTGCTGCAGGAAGGCCGCGACACCGGCGCGATGGTCAAGTACGGCTACTCCAGCAACGACCATCAGCAGGTGTACAGCACCGCCCTGTTCGGCCGTACCGAAGACCGCCGCATCGACGCCCTGGTCTACCTGACCAAGCGCGACGGCGATGACTTCAAGCTGGCCTCATCGCTGCCTGACGAGCGCAACCAGTACCCGATCAACCCCAAGCGCCTGCCCGACAGCGCCCAGGACCTCGAAGGCGGGCTGTTCAAGCTGAACGCCCAGCTCACCGATGAACAGTCCCTGGGCCTGTCCTATTCGCGCTCGAACAACCAGCGCATGACCCGCTACTCGTCGACCAACTACTCGACGCCGCCGACCCAGGCCAACATCGACCGCTATGGCTACGACCTGGCCATCCGCCGCTTCCTCGCCCACCGCGAAACCATCGACACCACCTGGTCGGCCAAGTACCGCTACCAGCCGCTGGACAATCCCCTGGTCAACCTGGAAGTCAGCTATTCCGAGTCCGATGTCGACCAGACCGACGAGCGCGGCCCCGACGCGTTCTACCAGCTCGCCAGTGGCGGCCGGCGCATGGAGACCGACTACAAGGACCGCAGCTTCGAAGTGCGCAACACCTCCCAGTTCAGCACCGGCGCGCTGGAGCACTCGCTGACCAGCGGCGTCAAACTGCTCCGCCACACCCGTGACACCGACATGTGGATGCCGGGCGCCGCGCAGAACACCGCCGCCTACAACTACGGTCACTTCCAGCCGAACTTCATGCCCCACGGCAAAGTGGACACCAACAGCGCCTACGTGCAGGACGCCATCACCCTCGGCCAGAACGACGCACCGTTCTACAACGTCGCCTCGGCCGGGCATGACTACAGCGCCAAGACCTACACCGGCTGGTCGCCGCGTCTGTCGGTGTTCTGGCGGGCCAGCGACGATGTCGCGTTCTTCGCCGACTACTCGAAGACCTGGCGCGCGCCGGTCATCGATGAGCAATACGAAGTGCAGAGCGCGGCCAGCACGCGCAGCGCCACCAGCCGCAACCTCGATCCGGAGCGCGTCACCGCCCTGCGTGTCGGCAACGTCACCGACTTCTCCGGCCTGGTCTTCGCCGACGACAACCTGCAGGTGCGCACCACCCTGTTCCACAACAAGATCAAGGACGAGATCTTCAAGAACCTCGGCATCGAGTGCCAGGCGCAAACCGTCACCGGTGGCAGCATCGGCCAGGCCTGCGGCAACTACCTGATCGGCAACTACCGCAATCTCGACGGCGTGACCTACAAGGGCTTCGAGGTGCCTACAACAACCCTGCGGGGTCCGGATGTCTGGGCGCGTGATGTGCCGGCACCGAAATGGGTGGCGCGTCTGGGCGTGAAAATTCCCGAGTGGGATGCGGTGGTGGGCTGGAAAGGCTTGTGGGTGCGTCAGACCGATCGCCTGCCGAGCGACAAGTACCCACCGGGTTACATGGGCAGCGCCCTGGGTGACAGCGCCTGGGACCATCGCGCCAACGACGCCTACAACGAGCAAGGCCTGTTCGCCAGTTGGAAACCGCAGCAGCCTTACCTGAAAGGCACCGAGGTCAACTTCACCCTCGACAACATGTTCAACCGCGATTACGCGCCGATGCTCAGCGACAACAACGTCTACAGCAAAGGCCGCAATGCCAAGGTGAGCATTACCCGGTTCTTCTGA

Transcript

HOLI00001.g51730.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7VNU1	TonB-dependent heme receptor A OS=Haemophilus ducreyi (strain 35000HP / ATCC 700724) OX=233412 GN=tdhA PE=2 SV=1
P44523	TonB-dependent heme receptor A OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) OX=71421 GN=tdhA PE=3 SV=1
Q4QP67	TonB-dependent heme receptor A OS=Haemophilus influenzae (strain 86-028NP) OX=281310 GN=tdhA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0049163 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07715 all species →	Plug	TonB-dependent Receptor Plug Domain	Domain	Interproscan
PF00593 all species →	TonB_dep_Rec	TonB dependent receptor	Family	Interproscan
PF07660 all species →	STN	Secretin and TonB N terminus short domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039426 all species →	Family	TonB-dependent receptor-like	Interproscan
IPR037066 all species →	Homologous_superfamily	TonB-dependent receptor, plug domain superfamily	Interproscan
IPR011662 all species →	Domain	Secretin/TonB, short N-terminal domain	Interproscan
IPR012910 all species →	Domain	TonB-dependent receptor, plug domain	Interproscan
IPR036942 all species →	Homologous_superfamily	TonB-dependent receptor-like, beta-barrel domain superfamily	Interproscan
IPR000531 all species →	Domain	TonB-dependent receptor-like, beta-barrel	Interproscan
IPR011276 all species →	Family	TonB-dependent haem/haemoglobin receptor	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30442 all species →	IRON III DICITRATE TRANSPORT PROTEIN FECA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006826 all species →	Biological Process	iron ion transport	Interproscan
GO:0009279 all species →	Cellular Component	cell outer membrane	Interproscan
GO:0019867 all species →	Cellular Component	outer membrane	Interproscan
GO:0015232 all species →	Molecular Function	heme transmembrane transporter activity	Interproscan
GO:0015886 all species →	Biological Process	heme transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16087	TC.FEV.OM3, tbpA, hemR, lbpA, hpuB, bhuR, hugA, hmbR; hemoglobin/transferrin/lactoferrin receptor protein	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →