Gene detail

Detailed information of HOLI00001.G51735 in Hydra oligactis

Genomic Location: HOLI00001:3494469...3496641
NR annotation: WP_175652227.1, beta-glucosidase BglX [Pseudomonas sp. Marseille-P9899]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g51735.t1

ATGACCGAAGCCGAGAAGATCGGCCAGTTGCGCCTGATCAGCATCGGCCCGGAAATGCCTCACGAGAAGATCCGCGAAGAAATCGCCGCCGGGCGCATCGGCGGCACCTTCAACTCCCGCACCGCCCCGGAAAACCGGCCGATGCAGGACGCCGCCATGCGCAGCCGGCTGAAGATCCCGATGTTCTTCGCCTACGACACCATTCACGGCAACCGCACCATTTTCCCGATCGGCCTGGGCCTGGCTTCAAGCTGGGACATGACCGCCATCGCCAAGGTCGGCCGTACCGCCGCCATCGAAGCTGCCGCCGACTCCCTCGACATGACCTTCGCACCGATGGTCGACATCGCCCGCGACCCGCGCTGGGGCCGCACCAGTGAAGGCTTCGGCGAAGACACCTGGCTGACCGCGCGGATCGGCGAGGTGATGGTCAAGTCGTTCCAGGGCAACAGCCCCGCCGACGCCGACAGCATCATGGCCATCGTCAAGCACTTCGCCCTGTACGGCGCGGTGGAAGGCGGGCGCGACTACAACACGGTCGATATGAGCCTGCCGAAGATGTACAACGACTACCTGCCGCCCTATCGCGCCGCCATCGATGCCGGCGCAGGCGGGGTGATGGTCGCGTTGAACTCGATCAACGGCGTGCCGGCCACCTCCAACACCTGGCTGATGAACGACCTGCTGCGCAAGGAGTGGGGCTTCAATGGCGTGACCATCAGCGACCACGGCGCGATCCAGGAGCTGATCCGCCATGGCGTCGCCAGCGATGGCCGCGAGGCGGCGAAGCTGGCGATCAAGGCCGGCATCGACATGAGCATGAACGACACCCTCTACGGCGAAGAACTGCCGGGCCTGCTCAAGTCCGGCGAAGTCAGCCAGGGCGAGCTGGACCAGGCCGTGCGCGAAGTGCTCGGCGCCAAATCACGACATGGGCCTGTTCAAAGACCCTCCCGCCTGCACCGCGAAGCCGCCCGTGACGTCGCCCGCCGCAGCCTGGTACTGCTGGAAAACCGCAACCAGACCCTGCCGCTGAAAAAGACCGGCACCATCGCCCTGGTCGGCCCGCTGGCCGATGCGCCCATCGACATGATGGGTAGCTGGGCCGCCGACGGTAAGCCCAAGCATTCGGTGACCGTTCGCGAAGGCCTGCGCCGCGCCGTCGAAGGCAAGGCGAAACTGGTCTACGCCAAAGGCTCCAACGTCACCGGCGACAAGGCTGTCTTCGACTACCTGAACTTCCTCAACTTCGATGCCCCGGAAATCGTCAACGACCTGCGTCCGGCCGCCGTGCTGATCGACGAAGCGGTCAAGGCTGCGCAGCAGTCCGACGTGGTGGTCGCCGTGGTCGGTGAGTCCCGTGGCATGTCCCACGAATCGTCCAGCCGCACCACCCTGGAAATCCCGGCCAGCCAGCGCGAACTGATCAAGGCCTTGAAAGCCACCGGCAAGCCGCTGGTCCTGGTACTGATGAATGGCCGGCCACTGTCGCTGGCCTGGGAACGCGAGCAGGCCGACGCATTGCTGGAAACCTGGTTCAGCGGCACCGAAGGCGGCAACGCCATCGCCGATGTGCTGTTCGGCGACTACAACCCGTCCGGCAAGCTGGCGATCACCTTCCCGCGTTCGGTGGGGCAGATCCCGATGTACTACAACCACATGCGCATCGGTCGTCCGTTCACCCCGGGCAAGCCGGGCAACTACACCTCGCAGTACTTCGAGGAGCCCAACGGCCCGCTGTATCCGTTCGGCTACGGCCTGAGCTACAGCGACTTCAACCTGTCGGCGCTGACCCTGTCGGCCACCACCCTGGACAAGGGCAAGAACCTCGAAGCCAGCGTGCGGGTGAAGAACACCGGCAAACGTGACGGCGAAACCGTGGTTCAGTTGTACATCCAGGACGTCGCCGCCTCCATGAGCCGTCCGGTCAAGGAATTGAAAAACTTCCAGAAGATCATGCTCAAGGCTGGCGAAGAGCGGGTCGTGACCTTCCGCATCAGCGAAGACGACCTGAAGTTCTACAACAGCCAGTTGCAGTTCGCGGCAGAACCTGGCGAGTTCAACGTACAGGTCGGCCTGGACTCCGAGTCGGTGCAACAGCAGAGCTTCAAACTGCTGTAA

Transcript

HOLI00001.g51735.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q56078	Periplasmic beta-glucosidase OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=bglX PE=3 SV=2
P33363	Periplasmic beta-glucosidase OS=Escherichia coli (strain K12) OX=83333 GN=bglX PE=3 SV=2
T2KMH0	Beta-xylosidase OS=Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1) OX=1347342 GN=BN863_22130 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011648 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00933 all species →	Glyco_hydro_3	Glycosyl hydrolase family 3 N terminal domain	Domain	Interproscan
PF14310 all species →	Fn3-like	Fibronectin type III-like domain	Family	Interproscan
PF01915 all species →	Glyco_hydro_3_C	Glycosyl hydrolase family 3 C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036881 all species →	Homologous_superfamily	Glycoside hydrolase family 3 C-terminal domain superfamily	Interproscan
IPR001764 all species →	Domain	Glycoside hydrolase, family 3, N-terminal	Interproscan
IPR026891 all species →	Domain	Fibronectin type III-like domain	Interproscan
IPR019800 all species →	Active_site	Glycoside hydrolase, family 3, active site	Interproscan
IPR036962 all species →	Homologous_superfamily	Glycoside hydrolase, family 3, N-terminal domain superfamily	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR051915 all species →	Family	Cellulose Degradation Glycosyl Hydrolase 3	Interproscan
IPR002772 all species →	Domain	Glycoside hydrolase family 3 C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30620 all species →	PERIPLASMIC BETA-GLUCOSIDASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0008422 all species →	Molecular Function	beta-glucosidase activity	Interproscan
GO:0009251 all species →	Biological Process	glucan catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05349	bglX; beta-glucosidase	EC:3.2.1.21	Biosynthesis of various plant secondary metabolites	ko00999	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →