Gene detail

Detailed information of HOLI00001.G51832 in Hydra oligactis

Genomic Location: HOLI00001:3608507...3611242
NR annotation: WP_095154683.1, MULTISPECIES: preprotein translocase subunit SecA [unclassified Pseudomonas]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g51832.t1

ATGTTTGCGCCTTTGTTAAAGAAACTCTTTGGAAGCAAGAACGAGCGTGAAGTCAAACGCATGCTCAAGACGGTTCAGTTCGTCAATGCTTTTGAAGAGCAGATGGTGGCCCTCTCCGACGAACAACTGCGGGCCAAGACCGCCGAGTTCAAAGAGCGCCTGGCAAAAGGCGAAACCCTCGACCAGTTGTTGCCCGAAGCGTTCGCAGTAGCCCGCGAAGCCGGCAAGCGGATCATGGGCATGCGCCACTTCGATGTGCAGCTGATCGGCGGCATGACCTTGCACGAAGGCATGATTGCCGAAATGCGTACCGGTGAAGGCAAGACGCTGGTAGCGACCCTGGGTGTGTACCTCAATGCCCTGTCCGGCAAGGGCGTTCACGTGGTAACCGTGAACGATTACCTGGCCCGCCGCGACGCCAACTGGATGCGTCCGCTGTATGAATTCCTCGGCCTGACCGTCGGCGTCGTCACGCCGTTCCAGCCCCCGGAAGAGAAGCGCGCAGCCTATGCCGCAGACATCACCTACGGCACCAACAACGAATTCGGCTTCGACTACCTGCGCGACAACATGGCGTTCAGCATGGAAGAGAAATTCCAGCGCGAGCTGAATTTCGCCGTGATCGACGAAGTCGACTCCATCCTGATCGACGAAGCCCGCACCCCGCTGATCATCTCCGGCCAGGCCGAAGACAGCTCCAAGCTGTACATCGAAATCAACAAGCTGATCCCGCGCCTCAAGCAGCACATCGAGGAAGTGGAAGGCGAAGTCACCCAAGAAGGCCACTACAAGATCGACGAGAAGTCCCGTCAGGTCGAACTCAACGAAGCCGGCCACCAGTTCATCGAAGAGATGCTCACCCAGGTCGGCCTGCTGGCCGAGGGCGAGAGCCTGTACTCCGCGCACAACCTGGGCCTGCTGACCCACGTCTATGCCGGCCTGCGTGCGCACAAGCTGTTCCATCGCAACGTCGAGTACATCGTCCAGGACGGTCAGGTCCTGCTGATCGACGAGCACACCGGCCGTACCATGCCGGGCCGTCGCCTTTCAGAGGGCCTGCACCAGGCCATCGAGGCGAAGGAAAACCTGAACATCCAGGCCGAAAGCCAGACCCTGGCCTCGACCACCTTCCAGAACTACTTCCGCCTCTACAACAAGCTGTCCGGCATGACCGGTACTGCTGACACCGAAGCGTTCGAGTTCGCCCAGATCTACGCCCTCAACGTGATGGTCATTCCGCCGAACAAGCCGTTGGCGCGTAAGGACTTCAACGACCTGGTCTACCTGACCGCCGACGAGAAGTACGTCGCGATCATCGCCGACATCAAGGAAAGCATGGCCTCCGGTCGTCCTGTCCTGGTGGGTACCGCGACCATCGAAACCTCCGAGCACATGTCCAACCTGCTCAAGAAGGAAGGCATCGATCACAAGGTTCTGAACGCCAAGTACCACGAGAAGGAAGCCGAGATCATCGCCCAGGCCGGTCGCCCGGGTGCGTTGACCATCGCCACCAACATGGCCGGTCGCGGTACCGACATCCTGCTGGGCGGCAACTGGGAAGTCGAAGTGGCTTCCATGGAAAACCCGACTCCCGAGCAGATCGCCCAGATCAAGGCTGACTGGCAGAAACGCCACCAGCAGGTGATCGAGTCCGGTGGCCTGCATGTGATCGCTTCCGAGCGCCATGAATCGCGCCGTATCGACAACCAGTTGCGTGGTCGTTCCGGTCGCCAGGGCGACCCGGGCTCCAGCCGTTTCTACCTGTCGCTGGAAGACAGCCTGATGCGCATCTTCGCCTCCGACCGGGTGAAGAACTTCATGAAGGCGCTGGGCATGCAGTCCGGTGAAGCCATCGAACACCGCATGGTCACCAACGCCATCGAAAAAGCGCAGCGCAAGGTCGAAGGCCGCAACTTCGACATCCGCAAGCAACTGCTCGAATTCGACGACGTCGCCAACGAGCAGCGCAAGGTGATCTACCACATGCGCAACAGCCTGCTGGCGGCCGACAACATCGGCGACACCATCGCCGAGTTCCGTCAGGAAACCCTCGACGCCACCATCAGCCAGCACATTCCGCCGCAGTCGTTGCCGGAACAGTGGGACGTTGTCGGTCTGGAGGCTGCACTGGCCAGCGATTTCGGCGTGAAACTGCCGATCCAGCAGTGGCTCGACGAAGACGATCACCTCTACGAGGAAACCCTGCGCGAGCGCTTGCTGAACGAGCTGCTGACCGCCTACAACGAGAAGGAAGAAAGCGCCGGCGCCGAAGCCCTGCGTACCTTCGAGAAACAGATCCTGCTGCGCGTCCTGGACGACCTGTGGAAAGACCACCTGTCGACCATGGATCACCTGCGCCACGGTATCCATCTGCGTGGCTACGCGCAGAAGAACCCGAAACAGGAGTACAAGCGCGAGTCGTTCACCCTGTTCCAGGAACTGCTGGACTCGATCAAGCGCGATGCCATCCGGGTTCTCTCCCACGTTCAGGTGCGCCGCGAAGACCCGATCGAAGAAGAAGCCCGTCTGCGCCGCGAAGCCGAAGAACTGGCCCAGCGCATGCAGTTCCAGCATGCCGAAGCGCCTGGTCTGGAAAGTGGCGAACTGCAGGAGGAAGGTGCAGAAGTTGCGCTGGCAGCACCTCCGGTACGCAACGACCTGAAACTGGGCCGCAACGAGCTGTGCTGGTGCGGTTCGGGCAAGAAGTTCAAGCACTGTCACGGGCAGATCAACTGA

Transcript

HOLI00001.g51832.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B0KFR8	Protein translocase subunit SecA OS=Pseudomonas putida (strain GB-1) OX=76869 GN=secA PE=3 SV=1
B1J3I9	Protein translocase subunit SecA OS=Pseudomonas putida (strain W619) OX=390235 GN=secA PE=3 SV=1
A5W8P2	Protein translocase subunit SecA OS=Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1) OX=351746 GN=secA PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010693 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01043 all species →	SecA_PP_bind	SecA preprotein cross-linking domain	Domain	Interproscan
PF07516 all species →	SecA_SW	SecA Wing and Scaffold domain	Family	Interproscan
PF02810 all species →	SEC-C	SEC-C motif	Family	Interproscan
PF21090 all species →	P-loop_SecA	SecA P-loop domain	Domain	Interproscan
PF07517 all species →	SecA_DEAD	SecA DEAD-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011130 all species →	Domain	SecA, preprotein cross-linking domain	Interproscan
IPR011116 all species →	Domain	SecA Wing/Scaffold	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR036670 all species →	Homologous_superfamily	SecA, preprotein cross-linking domain superfamily	Interproscan
IPR004027 all species →	Conserved_site	SEC-C motif	Interproscan
IPR014018 all species →	Domain	SecA motor DEAD	Interproscan
IPR000185 all species →	Family	Protein translocase subunit SecA	Interproscan
IPR036266 all species →	Homologous_superfamily	SecA, Wing/Scaffold superfamily	Interproscan
IPR044722 all species →	Domain	SecA, C-terminal helicase domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR011115 all species →	Domain	SecA DEAD-like, N-terminal	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30612 all species →	SECA INNER MEMBRANE COMPONENT OF SEC PROTEIN SECRETION SYSTEM	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0017038 all species →	Biological Process	protein import	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006605 all species →	Biological Process	protein targeting	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0031522 all species →	Cellular Component	cell envelope Sec protein transport complex	Interproscan
GO:0043952 all species →	Biological Process	protein transport by the Sec complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03070	secA; preprotein translocase subunit SecA	EC:7.4.2.8	Secretion system	ko02044	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →