Gene detail

Detailed information of HOLI00001.G52118 in Hydra oligactis

Genomic Location: HOLI00001:3983370...3985997
NR annotation: GEX25406.1, ATP-dependent zinc metalloprotease FTSH, chloroplastic [Tanacetum cinerariifolium]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g52118.t1

ATGGCACTCAGCGTTGAAGAAAAAGCTCAGATCGTTGCCGACTATCAGCAAGCCGCCGGCGACACCGGTAGCCCGGAAGTGCAGGTTGCTCTGCTGACCGCCAACATCAACAAGCTGCAAGGCCACTTCAAGGCCAACGGCAAAGACCACCACTCCCGTCGTGGTCTGATCCGCATGGTAAACCAGCGCCGCAAGCTGCTGGACTACCTGAAAGCCGAGGGCTTCGGTCCCGCGGCTGGCAGGCACGCCGGGCGTATCTATAAGTCGACCGTTACCCTCGAGACGGGCCGTATTGCCCGCCAGGCCTCCGGTGCCGTATTGGTCACCGTTGACAACGACGTCACCGTACTGGTGACCGTGGTTGGCGCCAAGCACGCCGATCCAAGCAAAGGCTTCTTCCCGCTGTCCGTGCACTACCAGGAAAAGACCTACGCTGCCGGCAAGATTCCTGGTGGTTTCTTCAAGCGTGAAGGCCGTCCTTCCGAGAAAGAAACCCTGACTTCGCGTCTGATCGACCGTCCGATCCGTCCGCTGTTCCCAGAAGGCTTCATGAACGAAGTGCAGGTTGTCTGCACCGTCGTCTCCACCAGCAAGAAGACCGATCCGGACATCGCTGCGATGATCGGTACCTCGGCTGCCCTGGCCATCTCCGGCATCCCGTTCGAAGGCCCTATCGGTGCCGCGCGCGTTGCCTTCCACGAGAGCACTGGCTACCTGCTGAACCCGACTTACGAGCAACTGGCTGCCTCCAGCCTGGACATGGTCGTTGCCGGTACTTCCGACGCCGTTCTGATGGTTGAATCCGAAGCCAAGGAACTGACCGAAGACCAGATGCTGGGCGCCGTGCTGTTCGCCCACGACGAATTCCAGGCCGTCATCCAGGCGGTCAAAGAGCTGGCCGCCGAAGCTGCCAAGCCTACCTGGGACTGGAAACCAGCCGTTGCCAACACCGAACTGCTGAACGCTATCCGCGCCGAATTCGGCGAAGCCGTTTCCCAGGGCTACACCATCACCGTCAAGGCTGACCGTTACGCTCGCCTGGGCGAACTGCGCGATCAGGCGATCGCCAAGTTCTCCGGCGAAGAAGGCCAGGCCACTGCCGGTGAAGTCAAAGAAATCTTCGGCGAAATCGAATACCGCACCGTTCGCGAAAACATCGTCAACGGCAAGCCACGTATCGACGGCCGCGACACCAAGACCGTGCGTCCGCTGAACATCGAAGTCGGCGTTCTGCCGAAGACCCACGGTTCGGCCCTGTTCACCCGTGGCGAAACCCAGGCGCTGGTCGTTGCGACCCTCGGTACCGCCCGCGACGCACAGTTGCTGGACACCCTCGAAGGCGAGAAGAAAGACCCCTTCATGCTGCACTACAACTTCCCTCCGTTCTCGGTGGGCGAGTGTGGTCGCATGGGTGGTGCTGGCCGTCGTGAAATCGGTCACGGCCGTCTGGCCCGTCGTTCGGTCCAGGCCATGCTGCCAGCCGCCGACGTGTTCCCGTACACCATTCGCGTGGTTTCGGAAATCACCGAGTCCAACGGTTCCAGCTCCATGGCTTCGGTCTGTGGTGCATCGCTGGCCCTGATGGACGCTGGTGTGCCGATGAAGGCGCCGGTTGCCGGTATCGCCATGGGTCTGGTCAAGGAAGGCGAGAAGTTCGCCATCCTGACCGACATCCTCGGTGACGAAGACCACCTCGGCGACATGGACTTCAAGGTTGCCGGTACCGCCAAAGGCGTTACCGCGCTGCAGATGGACATCAAGATCAACGGCATCACCGAAGAGATCATGGAAATCGCCCTGGGCCAGGCCCTGGAAGCGCGCCTGAACATCCTCGGTCAGATGAACCAGATCATCGGTCAGTCCCGTAGCGAACTGTCGGAAAATGCTCCGACCATGATCGCCATGAAGATCGACACCGACAAGATCCGCGACGTCATCGGTAAAGGCGGCGCGACCATCCGTGCCATCTGCGAAGAAACCAAGGCTTCGATCGACATCGAAGACGACGGCTCGATCAAGATCTTCGGCGAGACCAAAGATGCAGCAGAAGCAGCGCGTCAGCGCGTTCTGAGCATCACTGCCGAAGCCGAGATCGGCAAGATCTACGTCGGCAAGGTCGAGCGCATCGTCGACTTCGGCGCCTTCGTCAACATCCTGCCGGGCAAGGACGGTCTGGTTCACATCTCGATGCTGAGCGACGCTCGTGTAGAGAAAGTGACCGACATCCTGAAAGAAGGCCAGGAAGTCGAAGTACTGGTGCTGGACGTGGACAACCGCGGCCGTATCAAGCTGTCGATCAAAGACGTTGCTGCTGCCAAGGCATCGGGCGTCTAA

Transcript

HOLI00001.g52118.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B1J2B3	Polyribonucleotide nucleotidyltransferase OS=Pseudomonas putida (strain W619) OX=390235 GN=pnp PE=3 SV=1
B0KHX3	Polyribonucleotide nucleotidyltransferase OS=Pseudomonas putida (strain GB-1) OX=76869 GN=pnp PE=3 SV=1
A5W983	Polyribonucleotide nucleotidyltransferase OS=Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1) OX=351746 GN=pnp PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004219 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03726 all species →	PNPase	Polyribonucleotide nucleotidyltransferase, RNA binding domain	Domain	Interproscan
PF01138 all species →	RNase_PH	3' exoribonuclease family, domain 1	Domain	Interproscan
PF00575 all species →	S1	S1 RNA binding domain	Domain	Interproscan
PF03725 all species →	RNase_PH_C	3' exoribonuclease family, domain 2	Domain	Interproscan
PF00312 all species →	Ribosomal_S15	Ribosomal protein S15	Domain	Interproscan
PF00013 all species →	KH_1	KH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012162 all species →	Family	Polyribonucleotide nucleotidyltransferase	Interproscan
IPR027408 all species →	Homologous_superfamily	PNPase/RNase PH domain superfamily	Interproscan
IPR015848 all species →	Domain	Polyribonucleotide nucleotidyltransferase, RNA-binding domain	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR000589 all species →	Family	Small ribosomal subunit protein uS15	Interproscan
IPR005290 all species →	Family	Small ribosomal subunit protein uS15, bacterial-type	Interproscan
IPR036345 all species →	Homologous_superfamily	Exoribonuclease, PH domain 2 superfamily	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan
IPR009068 all species →	Homologous_superfamily	uS15/NS1, RNA-binding domain superfamily	Interproscan
IPR001247 all species →	Domain	Exoribonuclease, phosphorolytic domain 1	Interproscan
IPR036612 all species →	Homologous_superfamily	K Homology domain, type 1 superfamily	Interproscan
IPR003029 all species →	Domain	S1 domain	Interproscan
IPR015847 all species →	Domain	Exoribonuclease, phosphorolytic domain 2	Interproscan
IPR004088 all species →	Domain	K Homology domain, type 1	Interproscan
IPR004087 all species →	Domain	K Homology domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11252 all species →	POLYRIBONUCLEOTIDE NUCLEOTIDYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004654 all species →	Molecular Function	polyribonucleotide nucleotidyltransferase activity	Interproscan
GO:0006402 all species →	Biological Process	mRNA catabolic process	Interproscan
GO:0006396 all species →	Biological Process	RNA processing	Interproscan
GO:0003735 all species →	Molecular Function	structural constituent of ribosome	Interproscan
GO:0005840 all species →	Cellular Component	ribosome	Interproscan
GO:0006412 all species →	Biological Process	translation	Interproscan
GO:0000175 all species →	Molecular Function	3'-5'-RNA exonuclease activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006401 all species →	Biological Process	RNA catabolic process	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00962	pnp, PNPT1; polyribonucleotide nucleotidyltransferase	EC:2.7.7.8	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →