Gene detail

Detailed information of HOLI00001.G52298 in Hydra oligactis

Genomic Location: HOLI00001:4184915...4187082
NR annotation: WP_095159379.1, MULTISPECIES: thioredoxin [unclassified Pseudomonas]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00001.g52298.t1

ATGAGTCAGTACAACCCATACATATTCGATACCACCGTCGCAAACTTCGACCAGGTGGTGATCGCCAACTCGCACCACAAGCCGGTGCTGGTGGATTTCTGGGCCGACTGGTGCGCGCCGTGCAAGGCGATGATGCCGGTGCTGGCCAAGATCACCGAGGAATACCAGGGCGAACTGCTGCTGGCCAAGGTCAACTGCGATGTCGAGCAGGACATCGTTGCCCGCTTCGGCATCCGCAGCCTGCCGACCGTGGTGCTGTTCAAGGATGGCCAGCCAGTCGACGGCTTTGCCGGCGCCCAGCCGGAGTCGGCCATTCGCGCCCTGCTCGAACCCCATGTGCAGATGCCACCGCCGCCCGCCGCCGACCCGCTGGAACTGGCCCGGGCGCTGTTCGCCGAAGGCCGCTACAGCGAGGCCGAGGCTACTCTCAAGGCGCTGCTGGGTGAAGACAACAGCAATGCCGGCGCGTTGATTCTCTATGCCCGCTGCCTGGCCGAGCGCGGCGAACTGGGCGAAGCGCAAACCGTGCTGGACGCGGTCAAGAGCGACGCACACAAGGCCGAACTGGCCGGTGCCAAGGCGCAATTGACGTTCTTGCGCCAGGCCAAGGATCTGCCGGAAGTCGCCGACCTGAAAACCCGCCTGGCGCAGAATGCCGAAGACGACGAGGCGGCGTATCAACTGACCATCCAGCAGTTGTCGCGCCAGCAGTACGAAGCGGCGCTGGACGGGCTGTTGAAGTTGTTCAAGCGCAACCGTGGCTACGAAGGCGGGTTGCCGCACAAGACCCTGCTGCAGGTGTTCGAGTTGCTGGGCAATGACCATCCGCTGGTGGGGACGTATCGCCGCAACTTGCGCGATCACTGTGGGAGCCGGCTTGCCGGCGATGGCGTCCACCCAGGCAGCGATTTTGTGTCTGCCGGCCTCATCGCCGGCAAGCCGGCTCCCACGAAGTTGTCCGACCGGCCACCACCCCGTAGGAGCGGATTTACCCGCGAGACGAACGACAAGACGCTGAAGATCCATCACCCAAGCCACCTGACCAGCAAGCGCTTGCCCGCCGCCGTACTCCCCGCCAGCCCTTCGAGTTGCTCGAGCAACGCCGGCCCGTCCAGTTGCCCGGCCGTACGCAACAACTCCCGCGCCGCCAGCCACTGTGAATCATCGCCGCGCGGCTGCACGGCCGGGACGATCGCGGCAGGCGCACCCTGCTCGCTCACCCGCCCCGCCAGGCTGGCCCATTCGCTCGGGTCCAGTTCAATAGTCAGATCCACTGGCCATTCACCGATGTGTCCACGAATTCGCACGTTTGCACTCTCCACCGTTCAAGGCCGTCATGCTCCCACGCCCGCCAACGATCTCCAAGTGGCGCTGGCAAGCGCCAGCCAACCTGTTATAACATTTCAAAACTTTCCCGCCCGCTCCCGGAGTCTCGCCATGCGTCGCCTGTTGCTTGCCTTGCCTTTTGCCCTGCTGCCCCTGGCCGTAATGGCCCATGACGACCACGATCACGAGCATGAACACGGCAGCCTCGGTGCTCACGAGCATGGCGTCGCTCACCTCAATGCGGTACTCGACGGCAATAACCTGGAACTGGAAATGGAAAGCCCGGCGATGAACTTCGTCGGCTTCGAGCACGCCGCCGCCAGTGACGCCGACAAGGCCAAGGTCGCTGCCGTCCGGGCACAACTCGAACAACCGTTGAAGCTGTTCGGACTGACCGTCGCCGCCACATGCAGCGAAAGCGACGTGGAACTGGAAAGCCCGCTGTTCGGCGACAAACCCGCCGAGGATGACGATGGCGACGATCACGACCACGACCATGAGCACGGCCACAGCGACATTCACGCCCACTACCGGCTGCAATGCGCCAACCCCGACAAACTCAAGACGCTGGACCTGACCCCACTGTTCAAGACCTTCCCCGCAACCCGGAAAATCCAGCTACAACTGATCGGACCGAATGGTCAGCAGGGCGTCGAAGCCACACCCGACAACGCCACGATCAACTTCTAA

Transcript

HOLI00001.g52298.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P77395	Chaperedoxin OS=Escherichia coli (strain K12) OX=83333 GN=cnoX PE=1 SV=2
P51225	Thioredoxin OS=Porphyra purpurea OX=2787 GN=trxA PE=3 SV=1
P50254	Thioredoxin OS=Pyropia yezoensis OX=2788 GN=trxA PE=3 SV=1

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14559 all species →	TPR_19	Tetratricopeptide repeat	Repeat	Interproscan
PF00085 all species →	Thioredoxin	Thioredoxin	Domain	Interproscan
PF10986 all species →	DUF2796	Protein of unknown function (DUF2796)	Family	Interproscan
PF14561 all species →	TPR_20	Tetratricopeptide repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR005746 all species →	Family	Thioredoxin	Interproscan
IPR013766 all species →	Domain	Thioredoxin domain	Interproscan
IPR017937 all species →	Conserved_site	Thioredoxin, conserved site	Interproscan
IPR021253 all species →	Family	Protein of unknown function DUF2796	Interproscan
IPR036249 all species →	Homologous_superfamily	Thioredoxin-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45663 all species →	GEO12009P1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0015035 all species →	Molecular Function	protein-disulfide reductase activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00001.G52298.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →