Gene detail

Detailed information of HOLI00002.G18655 in Hydra oligactis

Genomic Location: HOLI00002:1620218...1622380
NR annotation: PBQ32167.1, methionine synthase [Sphingobacteriaceae bacterium]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00002.g18655.t1

ATGCATACCATACAAGAGGAATTAGAAAAACGCATTTTAGTGATCGACGGGGCCATGGGCAGTATGATCCAACAGTACAAGCTTACGGAAAAAGATTTCAGGGGGAAGCGCTTTGCCGACTGGCATAAGGACCTGCAGGGCAATAACGATTTGTTATCAATCACGCAACCACAGATCATTAAAGCCATTCATAAAGAATACCTGAAATCGGGCGCTGACATTATCGAAACCAATACTTTCAGCGATACCTCCATTGCGATGGCCGACTACGACATGCAGGAGCTCGTGTACGAGCTGAACTTCGAATCGGCGAAGATCGCGAAGGAAGCGATTGCCGAATTTAAAGCCGAGTTCCCTGAATTTGCCTCCATTCCCAAATTTGTGGCCGGTGCCATTGGCCCCACAAACCGCACACTGTCTTTATCTCCAAACGTGAATGATCCCGGCTTCAGGGCCATTACCTTTGATGAGCTGGTAGAATCCTATACGGAGCAGGTGCGCGGCCTCATCGACGGCGGTGTGGATGTGCTCCTGATCGAAACGATCTTTGATACGCTCAACGCCAAAGCGGCGCTGTATGCGATACAGATCTATGCTGAAAAGATAGATAAAAAAATACCGGTGATGGTTTCCGGAACCATTACCGATGCCAGCGGCCGTACCTTATCGGGGCAAACGACTGAGGCCTTTTTAAACTCGGTATCGCACGTGGATCTGCTGAGCGTGGGCTTGAACTGCGCGCTTGGCGCGAAAGACATGCGCCCTTACCTGGAAGAGCTTGCAACGAAAGCGCCCTTCTATGTGAGCGCTTATCCGAATGCAGGGCTGCCCAACCAGTTTGGGGAGTATGACCAGGATGCCCATGAAATGGGACACCAGATCGAAGATTTTTTAAAAGCAGGTTTTTTAAATATTGTGGGCGGATGCTGCGGCACCACGCCGGCGCATATCAAGCGCATTGCCGAGCTGGCCAGGGAATCGAAACCCCGTAAAAAACCGGAACCCGATACACTCATGCACCTGAGCGGTCTCGAGCCTTATACGATGACGCCGGAAAGCAACTTCCTGAATGTGGGAGAGCGCACCAACGTGACCGGTTCCAAAAAATTCCTCCGACTCATCAAAGAAGGCAATTTCGAAGAAGCGCTTTCCATTGCGCGCGACCAGGTAGAAGGCGGCGCGCAGGTGATCGACATCAACATGGATGAGGGCATGCTTGACAGCGAGAAGGCCATGACGAACTTCCTGAACCTCGTGGCTTCCGAGCCGGATATTTCCAGGGTTCCCATCATGATCGACTCCTCGAAATGGACGGTGATCGAAGCCGGTCTGAAATGCGTGCAGGGTAAAGCGATCGTGAATTCCATTTCCCTGAAGGAAGGAGAAGAAAAATTTATCGAGCAGGCGCATAAGATCAAGCAATACGGCGCTGCCGTGATTGTAATGGCCTTTGACGAAGTGGGACAGGCCGACACGTATGAGCGCCGCATCGAGATCTGCAAACGCGCTTACGACATCCTGGTTGATACGGTCAAGTTCCCTCCGCAGGATATTATTTTTGACCCGAATATTTTCCCGGTAGCCACCGGCATGGAAGAACATCGCCTGAATGCGCTTGACTTTTTCAATGCCACCAAGTGGATCAAGGACAACCTGCCTCATGCGAAAGTAAGCGGCGGAGTGAGTAATGTGTCTTTCTCGTTCAGGGGAAATGACCATGTGCGCGAGGCCATTCACGGTGCTTTCCTGTACCACGCCGTGAAAAACGGAATGGACATGGGCATTGTGAACCCGGCTCAGCTGCAGGTTTACGACGATATTGACAAGACCTTGCTGGAGCTGGTGGAAGACGTGCTGCTGAACCGCCGCGACGATGCCACGGAGCGACTGGTAGAGCATGCCGAATCGCTGAAGGGAATTACCAAGGAAAAAACGGAAAAAGACGAAGAGTGGCGCAAAGGCACGGTAGAAGAGCGCCTGAGCCATGCCCTGGTAAAAGGTATCGTGGAACATATTGATGCCGATACGGAAGAGGCGCGCCAGAAACTGGGCAGGCCGCTGCATGTGATCGAAGGCCCGTTGATGGATGGGATGAACGTCGTAGGCGATCTCTTCGGCAGTGGAAAAATGTTCCTACCCCAGGTCGTAAAAACGCGCGCGTGA

Transcript

HOLI00002.g18655.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9KUW9	Methionine synthase OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) OX=243277 GN=metH PE=3 SV=1
Q7MHB1	Methionine synthase OS=Vibrio vulnificus (strain YJ016) OX=196600 GN=metH PE=3 SV=1
Q8DCJ7	Methionine synthase OS=Vibrio vulnificus (strain CMCP6) OX=216895 GN=metH PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002666 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00809 all species →	Pterin_bind	Pterin binding enzyme	Domain	Interproscan
PF02607 all species →	B12-binding_2	B12 binding domain	Domain	Interproscan
PF02574 all species →	S-methyl_trans	Homocysteine S-methyltransferase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036589 all species →	Homologous_superfamily	Homocysteine-binding domain superfamily	Interproscan
IPR036594 all species →	Homologous_superfamily	Methionine synthase domain	Interproscan
IPR011005 all species →	Homologous_superfamily	Dihydropteroate synthase-like superfamily	Interproscan
IPR000489 all species →	Domain	Pterin-binding domain	Interproscan
IPR003759 all species →	Domain	Cobalamin (vitamin B12)-binding module, cap domain	Interproscan
IPR003726 all species →	Domain	Homocysteine-binding domain	Interproscan
IPR050554 all species →	Family	Methionine Synthase/Corrinoid	Interproscan
IPR011822 all species →	Family	Cobalamin-dependent methionine synthase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45833 all species →	METHIONINE SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0044237 all species →	Biological Process	obsolete cellular metabolic process	Interproscan
GO:0042558 all species →	Biological Process	pteridine-containing compound metabolic process	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0008705 all species →	Molecular Function	methionine synthase activity	Interproscan
GO:0009086 all species →	Biological Process	methionine biosynthetic process	Interproscan
GO:0046653 all species →	Biological Process	tetrahydrofolate metabolic process	Interproscan
GO:0050667 all species →	Biological Process	homocysteine metabolic process	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0031419 all species →	Molecular Function	cobalamin binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00548	metH, MTR; 5-methyltetrahydrofolate--homocysteine methyltransferase	EC:2.1.1.13	Cobalamin transport and metabolism	ko04980	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →