Gene detail

Detailed information of HOLI00002.G19097 in Hydra oligactis

Genomic Location: HOLI00002:2163273...2166801
NR annotation: MBI3518411.1, adenylosuccinate synthase [Bacteroidota bacterium]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00002.g19097.t1

ATGAATCGTAAATTTGATGGCTTTTTAAACAAAGTAGAGATTATGATCAAATCGGATGTGTTATTAGGCCTGCAATGGGGCGACGAAGGAAAAGGAAAAATCGTTGACGTTTTAACTCCTAACTATGATATCATCGCCCGTTTCCAGGGCGGACCGAATGCCGGCCACACGCTGGAGTTCAATGGCATCAAGCACGTGCTGCATACGATCCCAAGCGGCATCTTCCACCCGACGGCACTCAATGTGGTGGGAAACGGCGTGGTGATCGACCCGGTGATCTTCAAAAAAGAGATCGATGCACTCGTTGGCATGGGCGTTGACGTGAATAAAAAGCTGGTGATCAGCAAGCGCGCGCACCTCATCCTGCCCACGCACCGCCTGCTTGACGCAGCCAGCGAAGCCGCCAAAGGAAAAGACAAGATCGGTTCCACGCTGAAAGGCATCGGGCCAACGTATATGGATAAAACCGGCCGTAACGGCCTGCGCGTGGGCGATATCGAAAGCCCTAACTTCAAAGAAAAATACAATGCCCTGGTAGAGAAGCACAAGCAGCTGCTGGAGTTCCATAAGTTCGAGTACAACCTCGCTGAGCTGGAGCCGGCCTGGAAAAAGATCCTGGCTGAAGGAGCACAGGGCTCTTTACTGGACATCGATTTCGGCTCTTACCCTTTTGTAACCTCTTCCAATACGATCTGTGCCGGTGCCTGCAATGGCCTGGGCATTGCCCCGAATAAGATCGGGAATGTGATCGGGATTTTTAAGGCATACTGCACACGCGTGGGCAGCGGGCCTTTCCCAACGGAGCTTGATAATGAAGTAGGGGAGAAGATCCGACAGATAGGCCGTGAGTTCGGTGCTACCACAGGCCGCGCCCGCCGCTGCGGCTGGCTGGATATTCCGGCCCTGAAATATGCGATCGACATCAACGGCGTAACGGAATTGATGATGATGAAAGCCGATGTGCTTTCGGATTTTGATACCCTGCAGGTGTGTACGCATTACATGCACAAAGGCGAGAAAATTGATTATCTGCCGTTCAGCATCGAGCCGGCAGATGTGACGCCGGTGTATGAGGAAGTAAAAGGCTGGAACGTGGATTTAACGAAAATGACCAGCAAGGATGCCTTGCCAAAAGAACTGATTGACTACGTGAAGTACATCGAGAAATTAGTGGAAGTGCCTGTCAGCATCTTAATAGAAGTTCACAACGATTTTAGCAACAGTGTTATCATTGGCCTGCAACCGCGGGGAATCTACCTGGCACACCGCATTCAGAAATTGCTGGAAGGTATTTTAAAGAAAAAAGTACTTTGTGGCGACCTGGATACCACCTTTTACCGCGACGACTTCCGCAAAAAAGAGCTGAAGCCCAACAAAACCAATATTGATTTTATCATCGAGGACAAGAACGTGATCCTGGTGGACGACGTGTTGTTTACCGGCAGGACCATCCGCGCAGGACTCGACGCCATGCTGGCCTTTGGCCGCCCCAAAGATGTGGAGCTGCTGGTATTGGTCGACAGGCGCTTTAGCCGGAATGTGCCTATCCAGGCAAAGTACATTGGCCTGGTAATCGACTCGATTGAAACGCAAAACGTCAGGGTAGAATACATTGAGCTTGTGCCGGAAGGTGATGTCATCTCCGCGTTGGAAAACGATCAGGATGCTTTTTTGAGTTTTATCAAAAGCATTCCGGAATCGAAGGCTGAATACGCTTATGCGCCCGGCAAATGGACCGTAAAGCAGGTGATCAATCATGTGATCGACACGGAACGTATTTTCAGCTACAGGGCCTTGTGCTTTGCCCGTGGCGAAACACAAACGCTTCCTTCATTTGAGGAGAACGACTATGCCGCCAATGCCAATCTCAGCAGGACAGATCTGTTGATGCTGGCCCGGGAGTTTGACGTGGTAAGAAGGGCAACGGTCTTGTTGTTTAAGCAACTGGGAGAGAAAGAGCTGTTGACCAAAGGAACAACTCCTTCCGGTGTCAGCAATGTATTATCGCTGGGTTTCACCATCTGCGGCCATGGCAAGCACCACGTGAATGTGATGAAGGAACGAAAGTACCTTCCCTGGAGAGATATCACGGTGGCCAACCTCTTCTTCGAGAACTCCACGCGCACCCGCTTATCCTTTGAACTGGCACAAAAGCGCCTGAGTGCGGATGTGGTGAATTTTTCTGCCGCTTCTTCTTCGGTAAAAAAAGGAGAGACCCTGATCGATACCGTTAATAATATCCTGGCCATGAAAGTGGATATGGTGGTAATGCGCCATTCCAGCGCCGGTGCCGCCGAATTTTTATCGAAGCGTGTCAACGCAAAAATTGTCAATGCCGGCGACGGTGCCCATGAGCACCCGACACAGGCTTTGCTCGATGCGTTTTCCATGCAGGAAAAGCTGGGCGACCTCAAGGGAAAGAAGATTGCCATTGTGGGTGATATCTTACACTCGCGGGTGGCTTTATCTAATATTTTCTGCCTGCAAAAGCTTGGAGCGGAAGTAAAGGTCTGCGGTCCTACAACGCTTATTCCTAAATACATAGAGTCTCTGGGCGTGAAAGTGGAAAGCGATCTGCGTAAAACCCTTGAGTGGTGTGATGTGGCCAATATGCTGCGGATTCAGCTCGAACGGCAGGATATTAAATTTTTCCCGTCTATCCGCGAATACACCATGCTTTATGGCCTGAATAAAGAGCTGCTGGACTCTCTTCCTAAAAAGATCCTTATCATGCACCCGGGCCCGATCAACCGTGGCGTGGAGATTACCAGCGACGTGGCAGACAGCGATCAGTCCATTATCCTCGACCAGGTAGAGAACGGCGTCGCTGTGCGTATGGCGGTAATGTTCCTGCTCGCCGGCAGGCAGTAA

Transcript

HOLI00002.g19097.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A5FHR3	Adenylosuccinate synthetase OS=Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101) OX=376686 GN=purA PE=3 SV=1
A6H0U4	Adenylosuccinate synthetase OS=Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86) OX=402612 GN=purA PE=3 SV=1
A0LZF7	Adenylosuccinate synthetase OS=Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803) OX=411154 GN=purA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003484 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00185 all species →	OTCace	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain	Domain	Interproscan
PF02729 all species →	OTCace_N	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain	Domain	Interproscan
PF00709 all species →	Adenylsucc_synt	Adenylosuccinate synthetase	Domain	Interproscan
PF12867 all species →	DinB_2	DinB superfamily	Domain	Interproscan
PF00156 all species →	Pribosyltran	Phosphoribosyl transferase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006130 all species →	Family	Aspartate/ornithine carbamoyltransferase	Interproscan
IPR042109 all species →	Homologous_superfamily	Adenylosuccinate synthetase, domain 1	Interproscan
IPR036901 all species →	Homologous_superfamily	Aspartate/ornithine carbamoyltransferase superfamily	Interproscan
IPR006131 all species →	Domain	Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding domain	Interproscan
IPR006132 all species →	Domain	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding	Interproscan
IPR001114 all species →	Family	Adenylosuccinate synthetase	Interproscan
IPR002082 all species →	Family	Aspartate carbamoyltransferase	Interproscan
IPR024775 all species →	Domain	DinB-like domain	Interproscan
IPR034660 all species →	Homologous_superfamily	DinB/YfiT-like putative metalloenzymes	Interproscan
IPR029057 all species →	Homologous_superfamily	Phosphoribosyltransferase-like	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000836 all species →	Domain	Phosphoribosyltransferase domain	Interproscan
IPR042111 all species →	Homologous_superfamily	Adenylosuccinate synthetase, domain 3	Interproscan
IPR033128 all species →	Active_site	Adenylosuccinate synthase, active site	Interproscan
IPR018220 all species →	Binding_site	Adenylosuccinate synthase, GTP-binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11846 all species →	ADENYLOSUCCINATE SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006520 all species →	Biological Process	amino acid metabolic process	Interproscan
GO:0016597 all species →	Molecular Function	amino acid binding	Interproscan
GO:0016743 all species →	Molecular Function	carboxyl- or carbamoyltransferase activity	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004019 all species →	Molecular Function	adenylosuccinate synthase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006164 all species →	Biological Process	purine nucleotide biosynthetic process	Interproscan
GO:0044208 all species →	Biological Process	'de novo' AMP biosynthetic process	Interproscan
GO:0046040 all species →	Biological Process	IMP metabolic process	Interproscan
GO:0004070 all species →	Molecular Function	aspartate carbamoyltransferase activity	Interproscan
GO:0006207 all species →	Biological Process	'de novo' pyrimidine nucleobase biosynthetic process	Interproscan
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00002.G19097.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →