Gene detail

Detailed information of HOLI00002.G20114 in Hydra oligactis

Genomic Location: HOLI00002:3373127...3375995
NR annotation: MBK6985000.1, bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Bacteroidota bacterium]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00002.g20114.t1

ATGCCCCGAAAAAAAGCCGTACTGCCCGCCCTTGTAATCATGCAGAATATGCACCTGGTCCATGATTTCGAGGTTGTGGCTAGGCCTGTAGCGTTTTACCCCATGCTTTACCCGGTTGGAAGACTGGTCGGTGAAGCCCACCAAAAGCCCCATAAAAGCCGCCAGCAGCAGGGGTTTTCTTCCATCCGCATTTCCGCAAAACGAGAGCCTGTGATCAAAAAACTGAACGACCTGGGTGTTACCATTTACAGTACCGGTGGTACACAAACGTTTATAGAAAACCTCGGAGCACCTGTAAAGGCTGTGGAAAGCTTAACTGCTTTTCCTGAAATTTTAGGGGGCCGTGTCAAAACCTTACATCCGAAAATTTTCGGAGGCATCCTCGGGCGCCGTGAGCTCGACAGCGATGTTGCGCAAATGGAACAACACGAGATCCCGAACATCGACCTGGTAATCGTGGATTTGTATCCTTTCGAGGAAACCCTTGCCAGTGGTGCCTCAGAAGAAGACATCATCGAAAAGATCGACATCGGTGGCATTTCTTTGATCAGGGCTGCTGCCAAAAATTTCAACGACGTGGTGATCGTTTCCTCCAGAAATGATTATTCCTCCTTGTTGAATTTACTCAACGAAAAAAATGGCTTCTCGGATTTGTCGGACCGTAAAACCTTTGCGGCTAAAGCTTTTGCGATGAGCAGCCATTACGACTCCGCCATTTTCAACTACTTCAACAATACCGAAGATCTGCCGGTTTTAAAACACAGCCTCAACAACGGCGTCACCTTACGCTACGGCGAAAACCCTCACCAGAAAGGTGTGTTCTACGGCGATATGGAAGCCATGTTCACCAAGCTGAACGGAAAAGAATTATCGTACAACAACCTGCTCGACGTGGATGCTGCCGTGAATTTAATGGCTGACTTCACAGAGGAGCCAACCTTCGCGATCTTAAAGCACAACAACGCCTGCGGTGTGGCCTCGCGCCCTACCGTGCTGGAAGCCTACCTGGCAGCGCTGGCGGGTGATCCGACTTCGGCATTTGGCGGGATCCTGATTTCCAACAGGGAAATCGATTTTGAAGCGGCGGAAGAAATCCACAAGCTGTTTTGCGAAGTGAAACAGGTGGCGCTTCCTAAAAAGCAGATCCGCACTTTGCTGAACGGCATCATCGAACAGGACAAAGACAGCGTAACCGAAACCGAAGGCAACCTGCAAACCGTTACTAACGTTTCGCCTACTGCCGCTCAACTGAAAGACCTGCTGTTTGCCAACAAGCTGGCGAAACATACCAAATCCAATACGATCGTCATTGCAAAAAACAACCAGCTCATTGCAAGCGGCACCGGCCAGACCTCGCGCGTGGATGCTTTAAGACAGGCCATTGCGAAAGCACAGGCTTTCGGCTTCGACCTGAAAGGATGCGTGATGGCGAGCGATGCCTTTTTCCCCTTTGCGGATTGCGTCGAGATCGCTCACAAGGTAGGGATCGATACGGTAATTCAACCGGGCGGCTCTATCAAGGATAAAGATAGCATTGAATACTGCAATGCCAAAGGCATGAGCATGGACATTGCGATCGACTTAGGTACGGCAAATACCATCATTATTCACGACGAGAAAGTGGTTGTTGACCAGCCCAGTATTGTAGCCGTTGACAGAACCACCGGAAAAGTGATTGCTGTTGGAAAGCAGGCCCAGATGATGCATGGTAAAACGCACGAGAACATCAAGACCATCCGTCCGCTGAGGGATGGTGTGATTGCGGATTTCCAGGCGGCGGAAGAAATGATCAAGGGAATGATCAAGATGATCAACCCCGGCAACCGCCTGTTCAAGCCATCCTTGCGCATGGTGGTATGTATCCCGAGCGGTATTACCGAAGTAGAGAAACGTGCGGTACGTGACAGCTGCGAGCATGCCGGCGCCAAAGAAGTGTACATGATCCACGAGCCGATGGCTGCCGCTATCGGGATGGGCATCGACGTGGAAGAACCGATGGGCAATATGATCATCGATATCGGTGGAGGTACCTCTGAGATTGCCGTCATGGCCCTTGGCGGGATTGTGTGCGACAAATCAACCCGTATTGCAGGTGATGACTTTAATGCCAACATTGAAGAATACATGCGCCGCCAGCATAACATCCTCATCGGTGAGCGAAGCGCCGAGCAGGTAAAAATTGAAGTAGGTGCCGCCATGACGGAGATTGAAAATCCACCGGCAGACTATGCGGTACAGGAAGGGACTTAA

Transcript

HOLI00002.g20114.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8A155	Bifunctional purine biosynthesis protein PurH OS=Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50) OX=226186 GN=purH PE=3 SV=1
O67775	Bifunctional purine biosynthesis protein PurH OS=Aquifex aeolicus (strain VF5) OX=224324 GN=purH PE=3 SV=1
A6TLS7	Bifunctional purine biosynthesis protein PurH OS=Alkaliphilus metalliredigens (strain QYMF) OX=293826 GN=purH PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0094618 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02142 all species →	MGS	MGS-like domain	Domain	Interproscan
PF06723 all species →	MreB_Mbl	MreB/Mbl protein	Family	Interproscan
PF01808 all species →	AICARFT_IMPCHas	AICARFT/IMPCHase bienzyme	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004753 all species →	Family	Cell shape determining protein MreB	Interproscan
IPR011607 all species →	Domain	Methylglyoxal synthase-like domain	Interproscan
IPR043129 all species →	Homologous_superfamily	ATPase, nucleotide binding domain	Interproscan
IPR024051 all species →	Homologous_superfamily	AICAR transformylase, duplicated domain superfamily	Interproscan
IPR036914 all species →	Homologous_superfamily	Methylglyoxal synthase-like domain superfamily	Interproscan
IPR016193 all species →	Homologous_superfamily	Cytidine deaminase-like	Interproscan
IPR002695 all species →	Family	Bifunctional purine biosynthesis protein PurH-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11692 all species →	BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000902 all species →	Biological Process	cell morphogenesis	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0003937 all species →	Molecular Function	IMP cyclohydrolase activity	Interproscan
GO:0004643 all species →	Molecular Function	phosphoribosylaminoimidazolecarboxamide formyltransferase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006164 all species →	Biological Process	purine nucleotide biosynthetic process	Interproscan
GO:0006189 all species →	Biological Process	'de novo' IMP biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00002.G20114.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →