Gene detail

Detailed information of HOLI00002.G20141 in Hydra oligactis

Genomic Location: HOLI00002:3417869...3420852
NR annotation: MBI3519610.1, F0F1 ATP synthase subunit beta [Bacteroidota bacterium]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00002.g20141.t1

ATGTCTAACCAGATTGGTAAAATTGCTCAAGTTATTGGTCCCGTAGTGGACGTAAGTTTTGATTTGAATGGCGGAAAACTGCCTGACATTCTTGATGCATTGGAAATAGCTCGTGGAGGCACGCCTCTGATCCTTGAAGTTCAAAAACATATCGGTGAAGATACAGTACGTACCATTGCGATGGACAGTACAGACGGTTTATGCCGTGGTATGGAAGTAAAAACAACAGGTTCGGCTATCAAAATGCCAATCGGCGACAAAGTAAAAGGCCGTCTGTTCAACGTGGTAGGTGATGCCATCGATGGGATCAACACCATGAAAAAAGACGACGGTGTATCTATTCACCGTGCTGCTCCGAGATTCGAAGACCTTTCTACTTCATCCGAAGTATTATTTACAGGTATTAAAGTCATCGATTTGATCGAGCCTTACTCCAAAGGTGGTAAAATCGGTTTGTTCGGTGGTGCCGGTGTAGGTAAAACCGTATTGATCATGGAATTGGTAAACAACATCGCGAAAGCGTATGCCGGTTTATCCGTGTTTGCCGGTGTAGGTGAGCGTACCCGTGAAGGAAATGACTTATTGCGTGAGTTCATCGAGTCAGACGTAATTAAATATGGCGAGGAATTCAAACATGATATGGAAAAAGGCGGCTGGGATCTTTCGAAAGTGGATCTGAAAGCGCTGGAAGATTCAAAAGCAACCCTCGTGTTCGGTCAGATGAACGAGCCTCCCGGAGCACGTGCGCGTGTAGCCTTATCAGGATTAACCATGGCGGAATATTTCCGTGATGGAGACGGTACAGGACAGGGCCGTGATATCTTATTCTTCGTGGATAACATCTTCCGCTTTACACAGGCAGGTGCCGAAGTATCAGCCTTATTAGGCCGTATGCCTTCAGCGGTAGGTTACCAGCCAACCTTAGCCTCAGAAATGGGTGCGATGCAGGAACGTATCACCTCAACCAAAAGAGGTTCCATTACTTCCGTACAGGCGGTATATGTGCCTGCGGATGACTTAACGGATCCGGCGCCGGCTACAACCTTCGCCCACCTGGATGCTACTACCGTATTAAGCCGTAAAATTGCCGAGTTAGGTATTTATCCTGCGGTGGATCCTCTGGATTCTACATCAAGGATCTTAACTCCTTCGGTGATCGGTGATGCACACTACAACTGTGCCCAGCGTGTGAAAAACACCTTACAGCGTTACAAAGAATTACAGGATATCATCGCCATCTTAGGTATGGATGAGTTAAGCGAGGAAGATAAATTAACCGTACACCGCGCTCGTCGTGTTCAGCGTTTCTTATCTCAGCCTTTCCACGTAGCAGAGCAGTTCACCGGCTTAAAAGGCGTACTGGTTCCAATCGAAGAAACCATCAAAGGCTTCAACATGATCCTCGACGGTAAAGTAGATGAGTATCCTGAAGCAGCGTTCAACCTGGTTGGTTCTATTGAGGAAGCCATTGAAAAAGAAATTATTACTCCCGATAAAAAATTGTTCGAAGGACATGTGAAGTCTGCGGTATTCCCGGGTGCTGAAGGTTCTTTCGGTGTGCTCAATAACCACGCCGCCATGATCGCCACCTTAAAAAACGGCACAATCGAATTAACGGAAGATAATAACAATACACACCAGTTCCCAGTGAAAGGCGGTGTTGTGGAAACCAATGGCTATGCGAGGCGTTGGTTATTTCCTTATTTTCGGCTTTATATGTACAGCCTGCCCTTCTTTCCTGTAACAAAAAGCAACAGCAATGCCGGCTCAGTGATGCATAAGCTTTTTTATCTTCTGCTTTTCTTCTTTTTAGGCCACACCGCTCTGTCCCAGCAAAAGCAACTGGATTCATTAAAGTCTATCCTGAAAGAGAATATCCATGATACTACCCGGTTAAATACACTTTATGAGCTTATAGGTTATGCCCCTCAAGCGGATTGTTTTATATATAATAAAGAGATAATCCGCGCAGCCCAAAAGAATCTGAAGCAGGCAAAGTCTGGAACACCTTTACAGAAAAGGCTTTTATTTTTTCTGGCTCAGGGGTATTATAACGAAGGTGTGTTTTATACAGAGAAGGCCCTGTCTGACAGTGGTATGATCTTTTACCGGAAAAGCATGGAGATTAATCGTATGATCGAAAATTATGATGACATTGCTTATACGGAAGTGGAGATCTCCAAGATCCTGACAAACCAGGGCAATTATCCGGAGGCGATGGAGCTATTATACAAAGCACTGATACATTTCGAAAAAATTAATGATCTGGAAGGTGTCGGTGATGTCTATAAAGGACTTGGAAGGCTGTATTACAAACTGGGAAACAATAACAAATCGCTGAATGCGTTTTTTAAAGCCTATCGTCTTTATGAAAAGATTGATCAGAAAAGTGAAATGGCAAGTTCCTTATTCGGTATAGCTGTTATTTATTCAGCGATGAATAAGTACAGGGAGACGATACGTTATCTCAGAAAAAGCATCGCTCTGCAGAACCAGCTTGGTGAGCTGGTACAGGAAAGAGAGCAGGAAATGTTAAATGTGAGTCTTGGCTTAATGTACTCCAGAAAGATGCAGATGGACAGCGCGATTCCGTTTTTTGAAAAGAGCATTGAAATGGCTAAGCAGTCCAATAACCTGGTTGCACTGGGAGATCGCTATCTGCATCTTGCGGATGCTTATAACGGAAAAAACAATACAAAAAGGCCCTGGAATACTGTAGAAAGGCCTTATCTGCGGGCAGAGAAAATAACAATCTGGAAGTTGAGCAAAGCGCTGTAG

Transcript

HOLI00002.g20141.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0M791	ATP synthase subunit beta OS=Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803) OX=411154 GN=atpD PE=3 SV=1
Q11Y90	ATP synthase subunit beta OS=Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465) OX=269798 GN=atpD PE=3 SV=1
A6GVV9	ATP synthase subunit beta OS=Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86) OX=402612 GN=atpD PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003890 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02874 all species →	ATP-synt_ab_N	ATP synthase alpha/beta family, beta-barrel domain	Domain	Interproscan
PF13424 all species →	TPR_12	Tetratricopeptide repeat	Repeat	Interproscan
PF00006 all species →	ATP-synt_ab	ATP synthase alpha/beta family, nucleotide-binding domain	Domain	Interproscan
PF02823 all species →	ATP-synt_DE_N	ATP synthase, Delta/Epsilon chain, beta-sandwich domain	Domain	Interproscan
PF13181 all species →	TPR_8	Tetratricopeptide repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001469 all species →	Family	ATP synthase, F1 complex, delta/epsilon subunit	Interproscan
IPR020003 all species →	Active_site	ATPase, alpha/beta subunit, nucleotide-binding domain, active site	Interproscan
IPR050053 all species →	Family	ATPase alpha/beta chains	Interproscan
IPR005722 all species →	Family	ATP synthase, F1 complex, beta subunit	Interproscan
IPR004100 all species →	Domain	ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal domain	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR024034 all species →	Homologous_superfamily	ATPase, F1/V1 complex, beta/alpha subunit, C-terminal	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR036121 all species →	Homologous_superfamily	ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal domain superfamily	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR000194 all species →	Domain	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain	Interproscan
IPR020546 all species →	Domain	ATP synthase, F1 complex, delta/epsilon subunit, N-terminal	Interproscan
IPR036771 all species →	Homologous_superfamily	F0F1 ATP synthase delta/epsilon subunit, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15184 all species →	ATP SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015986 all species →	Biological Process	proton motive force-driven ATP synthesis	Interproscan
GO:0045261 all species →	Cellular Component	proton-transporting ATP synthase complex, catalytic core F(1)	Interproscan
GO:0046933 all species →	Molecular Function	proton-transporting ATP synthase activity, rotational mechanism	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0046034 all species →	Biological Process	ATP metabolic process	Interproscan
GO:1902600 all species →	Biological Process	proton transmembrane transport	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00002.G20141.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →