Gene detail

Detailed information of HOLI00256.G40440 in Hydra oligactis

Genomic Location: HOLI00256:114194...116394
NR annotation: WP_051686100.1, DUF3142 domain-containing protein [Pararheinheimera texasensis]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI00256.g40440.t1

ATGTCAGAACAGTTTTCCCTCCACGCCAGTAACAAAGTGCTGGCTGATGTGGTCAGTATCGAAGCCTTAACCGCCGGCGTGCGCCGGGTCCGGTTAAAACCGCAGGAACCGGTGCATTATCTGCCGGGTCAGTACTTACAGATTTTTTTATCCGACAGCGATAAAAGGCCGTTTTCAATTGCCAGTGCGCCGGGAGATGAATTTATCGAACTGCAGATTGGCGGGAATGTCACAGACGCTTACGCCAGTCAGGCGCTGACCCATTTGCAGGACAATCCGGCCGTGCTGATACAGGTCGGTCTCGGTGAAGCTTATTTACGCCCGGACAGCAACCGCCCTGTGCTGTTACTGGCCGGTGGCACTGGTTTCTCCTACGTTTGCAGCATCGCCAAAGCTTTAGCGCAGCAGCCGGATGGCCGCCCGGTGCAGCTGTATTGGGGCCTGCGCAATGAATCAGCCTTGTATTATCAGCAGGAACTGGCCGAGTTACAGGACATGCGTCCTGGCCTTGAGCTTGTCACCGTATTGCAGGAGCCTGAACAGGACTGGACTGGCCGCACCGGCCTAGTGCATGAAGCGTTGCTGGCCGATATTCCGTCTTTAGCCGGTTACGACATTTACATCGCCGGCCCTTTCCCTATGGTCAAAGCGGTACGTGATGCCTTCCTGGCTGCCGGTGCTGAGCGCGCGGGTTGTACACCGCCCGCTGCAGTCCTGCCGGCACCGGCTTATGAGCATCAGGTCTATATCTGGCAGCGTGTCTGGCGGCCGGCACATGCGCAAGCCCTGCAGCAAAGCCAACCAGATTTCTCACAGCTGCGGGTGCTCAGCCTGCAATTTCACTTAAGTAACACCGGCCCAGTCTGGACGCACACAGCGCCAGACTGGGCGTTATTGGCACGGGATCTGCGTCCGGTCACGCTGGTGCTGCGGCTGGATGGCCAGTTGTCACAACTGCCAACAGCCGATGTGTTGTGGCGACAACTACAGCCGCAGATTGCGGCGGCGCAGCAGGCCCAAGTCAAACTGCAGGCCATCGAAATTGATTACGACGCTGCCCGCGCTGCGTTAGCGCCCTATCGCCAGTGGCTGCAGCAACTGCGCCGGCAATTGCCCGCATCCTTGTCATTACAGATCACGGCGTTACCGGACTGGCTACAGTCAGAAGAGTATCCGGCACTTTGTACAGGCGGCAGACCAGCTGACGTTGCAATTGCATTCGTCTGCCCGTGGTTTCTGGCGCTGCCGGCTTATCATTCGGCGCTGATCGCAACTGCTGATGGTGGCCGCGTCGAAAGCGAAACTATGCTGCCGATTGCAGGAGAGCGTCAGGCTTTGCTGAGCCGGCCCGGGGCGGTGGCAGATTTTTTAAACTGGCTGCGAAGTCAGTCCTTACCGCAGCTCAAAGGCATTGTCTGGTTTCGTTTGCCGTTACCGGACGACCAGCGCAGCTGGCCACTGGTGACCTTACAGGCGCTGGTGCGCGGCGAGGCGCTCAGCGCGACGCTGCACACTGAACTGCAGGCAAATCAGGGGCGCTTTGATATTGCACTACGCAACACCGGCAATCTCAGTGCGCAGCTGCCGGACAACCTCAGCTTTCGCGGTTTACAATGTTTAGGCGGCGACGCCAGTGATGGCTATCAGTGGCGACAACAAGGCGGCGACTGGTGGTTACAGCGCAACAACACCACAGCAGATACAACGCAAATAGCGCCGCAACAAGCGCGAACTGTGGGCACTGGCTACGTTGTCAGCAATTACATCTCATCAGCACCCCAGCAGATTAAAAGGATTTTTATGACGTATTTTCGTTTTTCAGCACTGGCATCTGTTGTCCTGTTAGGTCTCAGCAGCACCCCGGCGCTGAGCTGTGGGCCGGATTTCCCGTTGCAGCTGCTGTCTGAGCGCGGCACACACCTGCAAAACCTGCCGGAACCGGAATTCGCGGTGCTGGTGACGCAATTAGCCAGCCAGCCGGCGTCGTGGCCTCGTACCGGAGAAAGTCTTCCAAAACCAATATGA

Transcript

HOLI00256.g40440.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9L6L9	NAD(P)H-flavin reductase OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=fre PE=1 SV=3
P0AEN3	NAD(P)H-flavin reductase OS=Escherichia coli O157:H7 OX=83334 GN=fre PE=3 SV=2
P0AEN2	NAD(P)H-flavin reductase OS=Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) OX=199310 GN=fre PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0012601 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11340 all species →	DUF3142	Protein of unknown function (DUF3142)	Family	Interproscan
PF00175 all species →	NAD_binding_1	Oxidoreductase NAD-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039261 all species →	Homologous_superfamily	Ferredoxin-NADP reductase (FNR), nucleotide-binding domain	Interproscan
IPR050415 all species →	Family	Multicomponent Reductase Electron Transfer	Interproscan
IPR017938 all species →	Homologous_superfamily	Riboflavin synthase-like beta-barrel	Interproscan
IPR021488 all species →	Family	Protein of unknown function DUF3142	Interproscan
IPR001433 all species →	Domain	Oxidoreductase FAD/NAD(P)-binding	Interproscan
IPR017927 all species →	Domain	FAD-binding domain, ferredoxin reductase-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47354 all species →	NADH OXIDOREDUCTASE HCR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI00256.G40440.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →