Gene detail

Detailed information of HOLI01051.G37139 in Hydra oligactis

Genomic Location: HOLI01051:210780...212919
NR annotation: MBW8463717.1, bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase [Acidovorax sp.]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI01051.g37139.t1

ATGGGAGCGGTTTGCCTGGCTCAAGAGCCGGGTGGTGGCACCCCGCGACAGCATTGGCCGCCCCGAGGTGCAGGCGCTGCGCGGCGTGGTGCTGCCTTTTGTGTTCCGCCGTTATCTGGACTACAGCGTGTTCGACGCGCTGCGCTCCCTGCACAGCCAGATCCGCGACCACGCCGCCAAGCGCAGCGCGGGCCACCCGAGCGTGCCAACGACGTGAAGCTCTCGCGCGGGGGCATCCGCGAGATCGAGTTCACCGTGCAACTGCTGCAGGTGGTGCGTGGCGGGCAGTTCCCCGAGCTGCGCCGCCGCCCCACGCTCGACGCCCTGCAGCGGCTGGCCCATGCGGGCCTCATGCCGCAGGCGACGGCCGACGCGCTGGGGCTGGCCTATGTTTTCCTGCGCCGGGTGGAGCACCGCATCCAGTACCTGGACGACCAGCAGACCCATGTGCTGCCCACGCGCGACGACGACCTGGCCTGGATCGCCCAGACCCTGGGCTTCAAGGACTGCTGTGCGAGTTCGACACCCTGCTGGGTGGTGCGGGCAAAAAACAATGCAACGGCGGCGGCTGTGGCGGGCCCCCGCGCCGCCGCGCCCCGCCGCGAACTGGAGGCCCTGCTGGAGCAGCTTCCCAACGGCTTTCGCGAACGGGTGGCCGAATGGCGCAGCCACCCGCGTGTGGAGGGCCTGCGCGACGAGGCGCGTGCGCGCCTGTTCCGCCTGGTGCAGCGCACCGCGCAGTGGCTCAAGGAAGGGCGTGTGACCGAAGAAGCCGCCGTGCGCCTGGTCAACTGGCTCGAACCCCTGCTGCGCCGCGAAAGCTACCTGGCGCTGCTGCTGGAGCGCCCCTCGGTGCACGAACAGCTGCTGCACCTGCTGGGCGCGGCCAAGTGGCCTGCGCGCTACCTGCTGCAGCACCCGGGCGTGATCGATGAGCTGGTGGGTGACCACCTCCTGTCCGAGCGGTTTGTGGTGGCCGACTTCGAGCGCGAGCTGGGCATGCGCCTGGCCTCGCTGCGCTCCACCGGCGAAGACGACGACGAAACTCTGCTCAACCTGCTGCGCCGCGCGCAGCACGCCGAAGCCTTCCGCACCCTGGCGCGCGATGTGGAACGCCGCATCACCGTCGAGCAGGTGGCCGACGACTTGAGCGCGCTGGCTGACAGCGTGCTGCGCATCACCAGCCAGTGGTGCTGGAGCCGCCTCAAGAACCGCCACCGCGACGAACCCCAGTTCGCCATCATTGGCTACGGCAAGCTGGGCGGCAAGGAGTTGGGCTATGGCAGCGACCTCGACATCGTGTTTGTGTTTGACGACGATGACGAGCGTGCGCCCGAGGTCTATGCGGCCTTTGTGCGCAAGCTCATCAACTGGCTCACGGTGAAGACTGGCGAAGGCGACCTGTACGAAATCGACACCGCCCTGCGGCCCAACGGCAACTCCGGCCTGCTGGTGACCAGCTTCGAGGCCTATGCCAACTACCAGCAGCAGCGCGGCAGCAACACCGCCTGGACCTGGGAGCACCAGGCCATGACGCGGGCGCGTTTTGTGATGGGCAGCGAGGCCTTGCGGGCGCGGTTTGACGCGGTGCGAGAAGCCGTGATCACCTCCAGCCGCGACCCGCTGGCCTTGCAGAGGCGAGATCGCGACCATGCGCGAGCGTGTGCGCTCGGCCCACCCCGCACCCGCCGGGCGCTTCGATGTGAAGCACAGCACGGGCGGCATGGTGGACGCCGAATTCGCCGTGCAGTATCTGGTGCTGTCGCAGTCGGCGGCCCACCCCGAACTGCGCGGCAACGTGGGCAATATTGCGCTGCTGCAGCGCGCCGAGCAGGTGGGCCTGCTGCCTGCCGGTGTGGGCATGGCGGCCGCCGACGCGTACCGCGAGCTGCGCCGTGTGCAGCATGTGGCGCGCCTGGACGAAGCCCCCACCCAGGTGACTCCCCCCGCACTGCAGGCCGAACGCGATGCGGTGCTGGCGCTGTGGCGGGCCGTGTTCGGCGCGGAGGCATAGTGCCCCCTCTGGCGGTGACAAATGGTTGCATCTTGGTGCGGCGCCGCTTCATGAAAAGTTCATTAATTCAAACAACTGTTTGA

Transcript

HOLI01051.g37139.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8XW19	Bifunctional glutamine synthetase adenylyltransferase/adenylyl-removing enzyme OS=Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000) OX=267608 GN=glnE PE=3 SV=1
Q63R39	Bifunctional glutamine synthetase adenylyltransferase/adenylyl-removing enzyme OS=Burkholderia pseudomallei (strain K96243) OX=272560 GN=glnE PE=3 SV=1
Q62HC7	Bifunctional glutamine synthetase adenylyltransferase/adenylyl-removing enzyme OS=Burkholderia mallei (strain ATCC 23344) OX=243160 GN=glnE PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0028166 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08335 all species →	GlnD_UR_UTase	GlnD PII-uridylyltransferase	Family	Interproscan
PF03710 all species →	GlnE	Glutamate-ammonia ligase adenylyltransferase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013546 all species →	Domain	PII-uridylyltransferase/Glutamine-synthetase adenylyltransferase	Interproscan
IPR005190 all species →	Domain	Glutamate-ammonia ligase adenylyltransferase, repeated domain	Interproscan
IPR043519 all species →	Homologous_superfamily	Nucleotidyltransferase superfamily	Interproscan
IPR023057 all species →	Family	Bifunctional glutamine synthetase adenylyltransferase/adenylyl-removing enzyme	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30621 all species →	GLUTAMINE SYNTHETASE ADENYLYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016779 all species →	Molecular Function	nucleotidyltransferase activity	Interproscan
GO:0008882 all species →	Molecular Function	[glutamate-ammonia-ligase] adenylyltransferase activity	Interproscan
GO:0000820 all species →	Biological Process	regulation of glutamine family amino acid metabolic process	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI01051.G37139.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →