Gene detail

Detailed information of HOLI04196.G44722 in Hydra oligactis

Genomic Location: HOLI04196:21221...23585
NR annotation: WP_069105339.1, mannitol dehydrogenase family protein [Acidovorax sp. RAC01]
Species Hydra oligactis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HOLI04196.g44722.t1

ATGAATTTCATCCTGCACCTGGGCCTGGGCTCGTTTCATCGCGCCCACCAGGCCGTTTATGTCCACGCACTGCGCCAGCAGGGCGACCGGGGCTGGGCCATCGCGGGCGGCAATCTGCGCCCCGACATGGCAGACACCATCGCCGCCTTGCAAGCCCAAGGTGGCCGCTACACGCTCGAGACCGTCACGCCCCAGGGCGAGCGCAGCTACACCGTCATCGAATCCATACAGCGCGTGATCCCCTACCAGGACGACCTGGCCCCGCTGATCGCTGTGGGTGCCGACACCGCCACGCGCATCATTTCGTTCACGGTCACGGAGGCGGGCTACTACCTCGATGCGCAGAACCAGCTGGACTGGGCCACCTTCCCCGACTTGCGTGCGGACCTTGATGCCGTCAAGGCCGGGCAGGCGGGCCACACCATCTACGGCGGCTTGGTCCGCATCCTGCGCGCGCGCATGGCGGCGGGCGCTGGGCCCGTCACGTTGATGAACTGCGACAACCTGCGCCACAACGGCGACCGCTCGCGCGGCGCGCTGCTCCAGTTCATCGGGGCCTTGGGCGATGCCGTGCTCAAGGACTGGGTAGAGCACAACACCACCAGCCCCAACGCCATGGTGGACCGCATCACGCCACGCCCCACGCTCGATGTGGCCGAGCGCGTGAAGGCTGCAACGGGTTGGGACGACAAAGCAGCACTCATGGGTGAAAGCTTTATCCAGTGGGTCATCGAAGACCATTTCATCGCCGGTCGCCCCGCGTGGGAAACGGTCGGGGTCGAGATGGTGCAGTCGGTGCAGGCGCACGAAGAGGCCAAGATCCGCCTGCTCAACGCCACCCACAGCTGCATTGCCTGGGCGGGCACGCTCGCGGGCTACCAGTACATCCACGAAGGCACACACGACGCGGCCATTCGCCAGATGGCCTACGACTACGTGACCGACGACGCGATCCCGGTGCTCCACACCCCAGAGCAACCTTGCCCCATCAACCTGGAGCAGTACCGCGACGTGGTGCTGGACCGTTTCGGCAACCCCGCCATCGCGGACACCAACCAGCGCGTGGCCATGGACGCGTTCTCCAAAATCCCCGGCATGATCGCGCCCACCCTCCGCGACAAGCTGGCGCGCAACGCGTCGTTCGACAGCGTGGCCATGCTGCCAGCGCTGTTCCTGGCTTACCTGCAGCGTTGGCACGCCGGGCAGATCCCTATACCTACCAGGACCAGGCCATGGACCCGGCCGTGGCGCACGCCATCTGCGACGCCGCTGACCCCGTGGCGGCCTACGCCGCCGACACGACCCTGTGGGGCGAGATGGCCAGCCACCCCCAGCTGCCCACCCACTGCCATGACCGTGAAGACGCCCACCGCCCCGCGCCAGACCAAGCCCGAGCTGGAGCACGACTACGTGCGCTCGCCCGCGCTGGGCTACGAGTCGCCGGACACTGCGGGCTTCATCCGCTGCCTGGCCCACGGCTTTCCCACGCCGCTGGCGCGCTGGCACTACCACGACGAGTACGAGCTGCACCTCATCACTGCGACGTCGGGCAAGGTGTTCGTGGGTGACTGGATCGGGCAGTTCCAGCCCGGCCACCTGGTGCTGACGGGCCCGCGCCTGCCGCACAACTGGATCAGCATGGACCTGCCCGAAGGCGGCGTGCCGCTGCGCGACTTGGTGATCCAGTTCTCGCACGCGCCGCTGGTGGCCAGCAGCGAGAGCATCCCCGAGCTGCGCGAGGTGCTGCCCCTGCTGGAGCGCGCGCGCCACGGCATCGAGTTTTTCGGCATGGAGTCGCAGGCGCAAGAGCACTGGCACCGCATCAAGGCGCGCCAGGGCCTGGCGCGGTTCGGTGCCGAGGACAACGACGCCCAGCTCGACCAGATCAACGCCATCGTGAGCCGCATTACCGACCACCTGGCCGAGCCGCTGGCCGCCGCCGACTTGGCACAGGAGCTGGGCATGACCGAGAGCCGCTTCTCGCGCTTCTTTCGCCGCGCCACGGGCAACACCTTTACCGATTTCGTGAACCTGGTGCGCGTGAACCGCGCCTGCCAGCTGCTCATGGAGTCCGACCGCTACATCACCCACATCGCGTACGACGTGGGCTTCAACAACATGGCCAACTTCAACCGCCGCTTCCTGGACATCAAGGGCATGACGCCCAGCGAATTCCGCAAGCAGGGCGCTGGAAGGTTTGGCAAGGTGTGA

Transcript

HOLI04196.g44722.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P58708	D-arabinitol 4-dehydrogenase OS=Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000) OX=267608 GN=dalD PE=3 SV=1
O52720	D-arabinitol 4-dehydrogenase OS=Klebsiella pneumoniae OX=573 GN=dalD PE=3 SV=1
P58709	D-arabinitol 4-dehydrogenase OS=Yersinia pestis OX=632 GN=dalD PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0028153 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01232 all species →	Mannitol_dh	Mannitol dehydrogenase Rossmann domain	Domain	Interproscan
PF12833 all species →	HTH_18	Helix-turn-helix domain	Domain	Interproscan
PF08125 all species →	Mannitol_dh_C	Mannitol dehydrogenase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000669 all species →	Family	Mannitol dehydrogenase	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR008927 all species →	Homologous_superfamily	6-phosphogluconate dehydrogenase-like, C-terminal domain superfamily	Interproscan
IPR037923 all species →	Homologous_superfamily	Transcription regulator HTH-like	Interproscan
IPR050988 all species →	Family	Mannitol Dehydrogenase/Oxidoreductase	Interproscan
IPR013131 all species →	Domain	Mannitol dehydrogenase, N-terminal	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR018060 all species →	Domain	DNA binding HTH domain, AraC-type	Interproscan
IPR050025 all species →	Family	D-arabinitol 4-dehydrogenase	Interproscan
IPR013328 all species →	Homologous_superfamily	6-phosphogluconate dehydrogenase, domain 2	Interproscan
IPR013118 all species →	Domain	Mannitol dehydrogenase, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43362 all species →	MANNITOL DEHYDROGENASE DSF1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0008866 all species →	Molecular Function	fructuronate reductase activity	Interproscan
GO:0016616 all species →	Molecular Function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	Interproscan
GO:0042840 all species →	Biological Process	D-glucuronate catabolic process	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HOLI04196.G44722.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Hydra oligactis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydra oligactis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →