Gene detail

Detailed information of HSymV2.0_g07.11452_t1 in Hydractinia symbiolongicarpus

Genomic Location: HiC_scaffold_7:3787906...3799543
NR annotation: XP_047142791.1, DNA polymerase delta subunit 2 [Hydra vulgaris]
Species Hydractinia symbiolongicarpus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HSymV2.0_g07.11452_t1

ATGACGTTCAATTTCAAGCCAGGTGGTTTTAATTTTGGTGGTACAACATCCAGTGCAGCCCCTGTTGGGGGTCAGTCAACATTTTCATTTGGTGGAGCGAATTCTACCTTGCCTGCTAACTCAACAACAGGAACGCAACCATCATTTAACTTTGCTAGTGGAAATACAGCGCCATCTGCTACTACTTCCACATTGGGTGGAACCGGATTTTCATTTAGTGCTGCATCAACTGCTGGTAGTACTGCGCAAACCATTGGTAGTAATTTTGGTTCATTAGGTGGGGCTAAACCATTCAGTTTTGGTGCAGCTACTGCCGTGACTACACAAGCAGCAGCTACAAAGCCCAACACCACTGCACCATTTGCTGGACTTAGTACAAGCAAAACAAATAATGCTCCACAGCAAAGCGGTTTTTCATTCTCAAACTCAACAACTAGTACTTCCGGTGGAATGTTTTCATCTAATCTACTAAAAGGCCAGACTACATCTGCTGCAGCAACTACGCCTTTTGCAGTAGCTTCAAGTGCAACTTCAACACCATCTTTGTCACTGGGTACTAGCACTGCTAAACAGTTCACCCTCTCCACTTCAACAACAGCAACAGCTTCGACAGGAAGCACCATTGTTTCTACTGGTGCAACGACCAACCTTGCATCAGCTGCGGCAACTCAACTCAAGCAAATGTCATACAAGGAACTTGAGGAAACAGTTGAAAAATGGCTTCATGATCTTGGAGAGCAAGAGAAAACATTTTTAAATCAAGCTTCTCAAGTTAATCTTTGGGATAGACAACTGATTGAAAATGGAGAGAAAGTGACAGAGTTGCATAATGAGGTTGAAAGAGTTAAATCTGAACAAAAGAGGCTAGATCGAGAATTAGACTTCATATTGTCTCAACAAGAAGAGTTGGAAGAGCTTTTGCAACCACTTGAAACGCAAGTAAAATCACAACAAGCATTGAAGCACTCACAACACTCTGATATAGAAAGGGAACGTACATTTAGAATGGCAGAAAACATAGATTCACAGTTAAAAACAATGATGCAGGACTTGAAAGAAATAATTGACTACATAAACAAATCTCACGTTTCACCTTCAAAAACTGATGACACTATGAGCCAAGTTGCAAAAATACTGAATGCGCATATGGACTCGCTACAGTGGATCGATCAAAATGCAAATCAGCTGCAGCAACGAATGAAGGACGGTCACCTGGAAAAATTTAGTTTCATCCAAACTGACAAAAAGAATATTATAATGACTGAATGCCATGCCCCAAGAAAATTATGCACATACCAAAATAAATCCGAAAAGTATTTATATACAAAAAAGAGAAAATTTGATTTGCAATACTCACAGTTATATGCTGTGAGATTAATCGCATTGAGAAAACGACTTCTAAACACATGCACTGAGAAATGGGGAAGTAAGTACCCTATTAAACAGCTGTCCGAGATTACCGAGAACGAAGCATGTTGTATTATTGGAACTTTATTTCGTAAAATGGAATTACAACCAAGTATATTAAAAGAAATATGTCAAGAGGAGGGCGTTTTACCCATTCCACACTCCACAAAGTATATTTCAGAGGAGGATGAACTAATTTTAGAAGAACAACAACAAAGAATTCTACTAGTTGGAAACATATCCACAATAATTTCAATAACAGGCGTTGTGGTTGCTGTTGCAGGATATCAAATACCAGGTGGTAAATTCTTCATTGAAGATACTTGTTATTGTGGAGTACCTAGTAGCACTAACATTAACATCGACCAAAGTTTATTAAATGGAGAGGACAGATACATAATTTTGCTTTCCGGGTTAGGGATTGGCAGTAAGCAGCAGAATATACTAAAACTGCAGATGTTGATTGATTTGCTGACTGGAAAACTCTCATCAGGAGAAGATCAGTTGAATCAAGCTAACATATGTCGTGTTATACTTGCTGGTAATTGTTTGAGTCGTGACACCCAAGACAAAGATTCCGAAAAAATTGCGAAATATCTCAGTCGAAACACGCAAGCGAAGAGCGTGGAAGCGATAAAATTGTTTGATGAAATGCTTGTTCAAATTGGTTCTTCGGTCCCTATTGATGTTATGCCTGGTGCACACGACCCAACAAATCAGTTCTTACCGCAGCAACCTCTACACAAGTGCATGTTCTCGAGCGTGTTGTCATATCCATATGTACAAAGTGTTACAAATCCATACGAAGCTGTCATTGGTGGAGTGAGGATACATGGAACATCTGGTCAGAATGTATCAAATATTTATCAATTTTCTGGCATGGATGACCGTCTTGACATTCTAGAAGCAACATTGAAGTGTGCTCACGTCTGCCCTACATCACCTGATACGCTAAGTTGCTATCCCTTCTATTCCGAAGACCCGTTTATCATCGATGAGTGGCCGGATATATACTTCGCAGGTAACCAACCTGATTTTCAAGCAAGAAAAACGGAAGGTGCAGACGGACAATCAGTTTTGCTGTTGTGTATCCCGTCATTTGAGGAGAGTGGTGTGTGCGTCGCTGTGAATCTTCGTGATCGTTCGTGTATTCCTATACATGTTAATGCAACTGTCAGATGA

Transcript

HSymV2.0_g07.11452_t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O93610	DNA polymerase delta subunit 2 OS=Xenopus laevis OX=8355 GN=pold2 PE=2 SV=1
P49004	DNA polymerase delta subunit 2 OS=Bos taurus OX=9913 GN=POLD2 PE=1 SV=2
Q6AXY4	DNA polymerase delta subunit 2 OS=Rattus norvegicus OX=10116 GN=Pold2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005521 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04042 all species →	DNA_pol_E_B	DNA polymerase alpha/epsilon subunit B	Family	Interproscan
PF05064 all species →	Nsp1_C	Nsp1-like C-terminal region	Family	Interproscan
PF18018 all species →	DNA_pol_D_N	DNA polymerase delta subunit OB-fold domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007185 all species →	Domain	DNA polymerase alpha/delta/epsilon, subunit B	Interproscan
IPR024826 all species →	Family	DNA polymerase delta/II small subunit family	Interproscan
IPR007758 all species →	Domain	Nucleoporin, NSP1-like, C-terminal	Interproscan
IPR040663 all species →	Domain	DNA polymerase delta subunit, OB-fold domain	Interproscan
IPR041863 all species →	Domain	DNA polymerase delta subunit 2, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10416 all species →	DNA POLYMERASE DELTA SUBUNIT 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0006271 all species →	Biological Process	DNA strand elongation involved in DNA replication	Interproscan
GO:0042575 all species →	Cellular Component	DNA polymerase complex	Interproscan
GO:0043625 all species →	Cellular Component	delta DNA polymerase complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02328	POLD2; DNA polymerase delta subunit 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of HSymV2.0_g07.11452_t1 across 44 RNA-seq samples of Hydractinia symbiolongicarpus. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

44Samples

44TPM > 0

3Conditions

198.2Max TPM

143.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Whole embryo	36	36	138.06	188.25
Whole embryo · Triptolide 20 uM	4	4	187.97	198.15
Whole embryo · DMSO 0.5%	4	4	150.37	155.77

Per sample · hover a bar for the full sample record

Show the sample table (44 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR24482167	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	188.25
SRR24482169	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	183.38
SRR24482177	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	182.15
SRR24482174	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	174.55
SRR24482165	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	172.63
SRR24482170	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	172.26
SRR24482139	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	170.98
SRR24482133	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	169.70
SRR24482173	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	169.54
SRR24482166	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	169.13
SRR24482176	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	166.96
SRR24482171	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	166.92
SRR24482144	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	159.27
SRR24482137	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	158.58
SRR24482143	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	156.82
SRR24482168	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	156.19
SRR24482175	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	155.45
SRR24482162	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	155.44
SRR24482135	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	154.23
SRR24482163	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	152.43
SRR24482142	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	151.47
SRR24482140	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	151.13
SRR24482134	Whole embryo	Whole embryo	5 hpf	not recorded	SRP436676	150.70
SRR24482172	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	149.57
SRR24482138	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	147.05
SRR24482153	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	145.91
SRR24482161	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	144.73
SRR24482145	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	143.63
SRR24482141	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	142.98
SRR24482136	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	135.77
SRR24482160	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	35.50
SRR24482159	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	29.98
SRR24482157	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	28.74
SRR24482155	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	27.13
SRR24482156	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	25.58
SRR24482158	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	25.52
SRR24482146	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	198.15
SRR24482149	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	186.81
SRR24482150	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	185.54
SRR24482147	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	181.38
SRR24482152	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	155.77
SRR24482154	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	154.11
SRR24482151	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	151.02
SRR24482148	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	140.59

Source: CnidoSite RNA-seq expression matrices (HSYMB_TPM, StringTie quantification over 44 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Hydractinia symbiolongicarpus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	49	HSymV2.0_g11.20431_t1	0.974136945054806
Negatively correlated	173	HSymV2.0_g04.06423_t1	-0.957260660150463

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydractinia symbiolongicarpus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →