Gene detail

Detailed information of HSymV2.0_g08.12873_t1 in Hydractinia symbiolongicarpus

Genomic Location: HiC_scaffold_8:2522039...2530938
NR annotation: XP_002164134.1, histone acetyltransferase KAT6A isoform X1 [Hydra vulgaris]
Species Hydractinia symbiolongicarpus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HSymV2.0_g08.12873_t1

ATGCAAAATGTTGGGAGAAAACCTTCTGCAATTGTTAACTTTATGGTGAAAAAAGAGAATAACGATGGGGATGATGAAGAAGAAGATATCACAGCAGAAGAAAGGGCTGCTTTGCGCGAAATTTGTGGATTCTGTAAAGGGACTCGGGATAAAAATAAATATGGCGAGGATGAAGATCTCCTTACATGCGATGATTGTGGAAACAGCGGCCATCCCACATGTATGCAGTATTCTCGTGATCTTACAGCTCGTGTTAGGGAAGAACCATGGCAGTGTATGGAATGTAAAAAATGCAATATTTGTAAAGAGCAAGGGGAGGCAGCTAATTTGCTGTTTTGTGATGCATGTGATAAAGGATATCATATGGAATGCTTACAACCACCCCTAGATGACATGCCAATTGGTAGTTGGGTGTGTGATCCATGTGTGTCTGAACAAAATGGTAAACGACGAAGAACTTCCATACCTGCTTCCTTGTTATTGCAGTCTCCTGAACAGCATTTTGTAAAAACTCCCAGTTCGGGTAGAAAAGGTGCACAAAAAAGAAAAGGGCCAGGAGGACCTATGGATGAAGAAAATAGTAAAGGATGTCCAACTCCTGGTTGTGATGGTTCTGGAAACTCAGTAGGGAAATTTGAAAAACATAGAAGTGCCCAGTTTTGTCCATTGATACATGGTCAGAAGAAAAAGCGGGGAGCAACTGATGAGGATGAGGACGATGAAGAGGATAGACAATTAACTCCTCCTCCGCGATTACCCGGAGTCACTGAAAAGGACGAGGAACTCTTCCAATATGCAAGTGCTCCGAAGCTTTACCTATGCGAATTCTGTCTCAAGTATATGAAAACGCGGACGATTTTAAAAAGACATTTACTTAAATGTAATTGGAGTCATCCACCAGCAAACGAAATATACAGAAAAGATAATTTATCAATGTTTGAAGTGGATGGAGCTGTGAGCAAGATATACTGCCAAAACCTCTGTTTACTGGCCAAACTATTTCTGGATCATAAAACATTGTATTATGATGTCGAACCGTTTTTATTTTACGTTCTAACCAAAAATGATAACACTGGAAGCCATCTTGTTGGATACTTCTCGAAGGAAAAAGCTTGTCAACAGAAATACAACGTCTCGTGTATAATGACGATGCCTCAATATCAACGACAAGGATATGGTCGCTTTCTGATAGATTTTAGTTACTTGTTATCAAGAATTGAAGGCCAGCCTGGATCTCCTGAAAAGCCACTTAGTGACCTAGGCTTGATAACGTATAGAAATTATTGGAAGAGCGTCATTGCTGAATATTTATATAACCATATGTATGATAAAGCCGTAACTATTAAATCTATTAGTTTAGCGACTGGCATGGATCCACATGATATTGCAGCCACGCTTCAACAGTTAAATGTCGTGCAACTTCGTAATGGAAAAGTTACGATCGTTATTAACGAGCGTGTTATTGGCGATCAAATGGCAAAGGTGAAACTGCAAAAGCGCATCGCTATTGACGAAGAGGCTTTACGTTGGACCCCTTTGGTACAGTCCGGTAATCCAGCACAGATCATGAAAGATGCTCATCTTTCTTCCGAGGACGAAGACGACACTGAAGATGGAGAGAAAAAGAAATCTACAGAAAGCTCTGATACTTCACCAGAAAAATTACCCAATGGTGTCCAAAATGATGAAGTTGTAAAAAAGATAGAATACAGCGACGTTGAAATGAGTGGCGAAGATTTAAAAAAAGAGCAAGAACAATCGGGTGATTCGAAAGAATCTGAAAGCTCAAAAGACGAAGTTGAGAAGAAAGGTGTTACTGCTGAAAACAATAACGATATAACGAAAAGTGATAGTGCTAGTGGCAATGACAATTTAGAAACGAAAGAAGCTAAAAACACCAAAGTAGCACCAACCACTCCTGATGAGCCGATGGAAACCAACAACGTAGACGAGAAGGCGGAGACTGAAGTCAAAGAATCGAAAGAAACTGACGTCGACACACCAATTAAAACTGAAGTGGACAAATCAAGTGAAACTGAAGTCGAGAAACCAGGTGAGTGTGAAGCTGAGAAACCAAATGAGACGGAAATCGAGAAACCCAGTGAGACTAAAGTCGAGAAACCAAATGAGAGTAAAGCCGAGAAACCAAGTGGGACTGAAGTCGAGAAACCAAGTGAGACTGAAGTCAAGAATACATCCGAAACTGAAGTCGAGAAGACACCAAGAGACACAATTCCCGAAGAAGAAGAAAAACCAGAATCTTCGAATGAAAAATCCTCAGTTGACGAAAAACAGGCTGAAGGGATGCAATCTTAA

Transcript

HSymV2.0_g08.12873_t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8WML3	Histone acetyltransferase KAT6B OS=Macaca fascicularis OX=9541 GN=KAT6B PE=2 SV=1
Q5TKR9	Histone acetyltransferase KAT6A OS=Rattus norvegicus OX=10116 GN=Kat6a PE=1 SV=2
Q8BZ21	Histone acetyltransferase KAT6A OS=Mus musculus OX=10090 GN=Kat6a PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000832 (this species only) · gene tree & orthology
Transcription factor family	zf-C2HC · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17772 all species →	zf-MYST	MYST family zinc finger domain	Domain	Interproscan
PF01853 all species →	MOZ_SAS	MOZ/SAS family	Family	Interproscan
PF01530 all species →	zf-C2HC	Zinc finger, C2HC type	Family	Interproscan
PF00628 all species →	PHD	PHD-finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002717 all species →	Domain	Histone acetyltransferase domain, MYST-type	Interproscan
IPR040706 all species →	Domain	MYST, zinc finger domain	Interproscan
IPR036060 all species →	Homologous_superfamily	Zinc finger, C2H2C-type superfamily	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR001965 all species →	Domain	Zinc finger, PHD-type	Interproscan
IPR019787 all species →	Domain	Zinc finger, PHD-finger	Interproscan
IPR002515 all species →	Repeat	Zinc finger, C2H2C-type	Interproscan
IPR050603 all species →	Family	MYST family histone acetyltransferases	Interproscan
IPR019786 all species →	Conserved_site	Zinc finger, PHD-type, conserved site	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR016181 all species →	Homologous_superfamily	Acyl-CoA N-acyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10615 all species →	HISTONE ACETYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004402 all species →	Molecular Function	histone acetyltransferase activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0000790 all species →	Cellular Component	chromatin	Interproscan
GO:0003712 all species →	Molecular Function	transcription coregulator activity	Interproscan
GO:0045892 all species →	Biological Process	negative regulation of DNA-templated transcription	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11378	SAS3; histone acetyltransferase SAS3	EC:2.3.1.48	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of HSymV2.0_g08.12873_t1 across 44 RNA-seq samples of Hydractinia symbiolongicarpus. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

44Samples

44TPM > 0

3Conditions

617.3Max TPM

241.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Whole embryo	36	36	217.36	617.31
Whole embryo · Triptolide 20 uM	4	4	210.66	221.56
Whole embryo · DMSO 0.5%	4	4	484.42	563.81

Per sample · hover a bar for the full sample record

Show the sample table (44 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR24482161	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	617.31
SRR24482162	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	584.33
SRR24482163	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	559.12
SRR24482153	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	461.98
SRR24482133	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	359.72
SRR24482134	Whole embryo	Whole embryo	5 hpf	not recorded	SRP436676	234.75
SRR24482142	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	226.01
SRR24482141	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	216.21
SRR24482145	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	214.92
SRR24482136	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	214.25
SRR24482140	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	213.88
SRR24482138	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	210.90
SRR24482166	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	197.36
SRR24482177	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	192.76
SRR24482168	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	190.51
SRR24482165	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	188.78
SRR24482143	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	187.31
SRR24482144	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	186.41
SRR24482135	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	185.07
SRR24482170	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	179.87
SRR24482167	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	179.30
SRR24482172	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	178.34
SRR24482169	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	166.01
SRR24482171	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	165.44
SRR24482137	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	164.31
SRR24482160	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	161.84
SRR24482174	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	160.80
SRR24482173	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	157.93
SRR24482175	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	156.22
SRR24482159	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	148.45
SRR24482139	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	138.50
SRR24482176	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	137.41
SRR24482157	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	94.72
SRR24482158	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	87.74
SRR24482156	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	69.64
SRR24482155	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	36.74
SRR24482149	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	221.56
SRR24482147	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	211.38
SRR24482146	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	206.44
SRR24482150	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	203.27
SRR24482148	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	563.81
SRR24482154	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	471.27
SRR24482151	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	468.49
SRR24482152	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	434.11

Source: CnidoSite RNA-seq expression matrices (HSYMB_TPM, StringTie quantification over 44 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Hydractinia symbiolongicarpus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	31	HSymV2.0_g15.25569_t1	0.962548509427907
Negatively correlated	9	HSymV2.0_g12.20949_t1	-0.848576664672708

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydractinia symbiolongicarpus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →