Gene detail

Detailed information of HSymV2.0_g08.12945_t1 in Hydractinia symbiolongicarpus

Genomic Location: HiC_scaffold_8:3656588...3676645
NR annotation: XP_002156663.3, putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase [Hydra vulgaris]
Species Hydractinia symbiolongicarpus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

HSymV2.0_g08.12945_t1

ATGGCAGACGGAGGACTGAGCTTTACCTTGAGGAAACACTGGAAAAAATCAACAGTTGCTGCTTGTTTACTTGTGTATGGGATAAACTATGGATCGAAACGATACAGGGAGTTTTTAATCAGAAGAGAATATTTTCAAGAAGCTAAGAAATATGGGGACCAGTCTTGCAGTCCATTAGAAAAACCGAGAAGGTTGTATGTCATATTGAATCCGCAAGCTGGCAACAGTAAATGTAAAAAGCTTTTTCAGAAAAACGCTGCTCCCATTTTTTACTTGGCAGGTATTGATGTCACCTTCATACAAACTGATTATGAAGGACACGCAAAAACAATCGCAAACTATTTTGATCGTAATATGGATGGTGTTGTTGTTGCTGGTGGTGATGGAACATTACAGGAGGTGGTGACTGGTATGCTTCGACAAGCACAACATGATAATCTTCTGCACCTTCCAATTGGTGTTTTACCAATGGGTTATCACAGTAATTCAATCTTTAGCAAGCTATTCACTCCTGACAAAGTAAAAGTAAAAAATATATGCGAAGCAGCAATGGCAATTGTCAAAAACAAAACACGAAAGGTTAGCGTCATGGAAATAAAGGCAGATTCGAAATCAAGTTTTGCCTTATCGAGCATTCATATTGGTTTAAATCAGCAAGTCAAAGAACAGATTGACCAAGGACGATTTTGGCTACTGGGACCACTAAAGAAATATTTCACATATCTATGGAGAACGACAAAGGAGTGGCCACCATCTTCGTCGATCCACGTGTACTCTTCTTCTATAAGTCCGTTACGAACTTCACTGTCACAAAAACAACATTCAATACCTAATTTGAAAATACAAACAGCTTCATGCGAGGAGAGAAATAAACTCAGGCAATCTAACAGTGAAAGCATAGAGAAACCATGTCATGATACGATTGCAAAACATGTTATATCGTGTGAAATGACTGGTTCTTACAAGCCAAATATAATAAACTGTAGTGAGAGAAAAGAATTTTTTAGCAGCGATATAAATTTATATTTTCGGGAAGCTGATGAAAAAAATACGGGACCCTATTTTATATTGCAAGACCTTAAAGTTGACCAATCAAAGACAGACTTTATGAAATATGGAGTTCAGTGGATCCAAAATAGATTTAATTATACACCCACGGATTTGTCAGACACGATGATATGTCATGATGTGCGTTTAACTCCTCCTGAAAACGAGGATTTATCATATGGCATAGACGGCGAAATATTTGATGCAAGACCTATTCAGAGTAAATATTCAAAGAACATGGGACGATCATCAAAGGACAAACGAGATGTTTACTACAGACTTGCAAAAGAAGGAGGGTGGAGAGCAAGAAGTGCTTTCAAGTTATTACAAATAAACGAAGATTTTGATTTGTTCACGGGGGTTAAACGGGTAGTTGATTTGTGTGCAGCACCTGGTAGTTGGAGTCAGGTTTTAAGTCGGAAACTTATCGAAGAACGTCAAGGGAATAACGAAGACGTGAAAATTGTCGCCGTCGATTTGCAAGCAATGGCACCTCTGCCGGGCGTCATACAAATTCAAGGAGATATAACGAAGCTATCAACTGCGAACGAAATAATCCAGCACTTTGAAGGAGAGCCTGCAGATCTTGTTGTATGCGATGGGGCACCGGATGTGACAGGATTGCACGACATAGATGAATACATTCAAGGACAACTACTACTCGCTGCCTTCAACATAACAAGTCACGTGTTAAAAAAAGGCGGCAATTTTGTGGCGAAAATCTTCCGCGGAAAAGATGTGGATTTGTTGTACTCTCAGTTAAAACTATTTTTTCCAGATGTAACCGTGTGCAAACCAAGAAGCAGTAGGAACTCCAGCATAGAGTCTTTTGTCGTGTGTTTAAATTATTCACCTCCTGAAGGTTATAAACCTACCATGGCTAATCCTCTGTTAAATCAAGACCTCGACTACAGCAGTTTGGAAGGTATCAATCGAGTGGTGACTCCTTTTATGGCTTGTGGCGATCTAAATTCATATGATTCAGATATGACCTATCCGTTAAACTTAGAAAAGGGGAAGGAATACATTCAACTACCGCCCACCCAGGCGCCAATCAAACCGCCTTATCAAACCGCCTGCGAATTGAAAAAGAAAAACCTTATACAAGAAGAAGGACTGTCTGTTACAACACAAATTAATGACGATATAAATAAAGAAGAGACCACGTGA

Transcript

HSymV2.0_g08.12945_t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CBC7	tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase OS=Mus musculus OX=10090 GN=Ftsj1 PE=1 SV=1
Q9UET6	tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase OS=Homo sapiens OX=9606 GN=FTSJ1 PE=1 SV=2
Q22031	Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase OS=Caenorhabditis elegans OX=6239 GN=R74.7 PE=3 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006901 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00781 all species →	DAGK_cat	Diacylglycerol kinase catalytic domain	Family	Interproscan
PF19712 all species →	AGK_C	Acylglycerol kinase C-terminal	Domain	Interproscan
PF01728 all species →	FtsJ	FtsJ-like methyltransferase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001206 all species →	Domain	Diacylglycerol kinase, catalytic domain	Interproscan
IPR015507 all species →	Family	Ribosomal RNA large subunit methyltransferase E	Interproscan
IPR045579 all species →	Domain	Acylglycerol kinase, C-terminal	Interproscan
IPR028590 all species →	Family	tRNA (cytidine(32)/guanosine(34)-2-O)-methyltransferase TRM7	Interproscan
IPR002877 all species →	Domain	Ribosomal RNA methyltransferase, FtsJ domain	Interproscan
IPR050082 all species →	Family	Ribosomal RNA large subunit methyltransferase RlmE	Interproscan
IPR017438 all species →	Homologous_superfamily	Inorganic polyphosphate/ATP-NAD kinase, N-terminal	Interproscan
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR016064 all species →	Homologous_superfamily	NAD kinase/diacylglycerol kinase-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10920 all species →	RIBOSOMAL RNA METHYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan
GO:0001510 all species →	Biological Process	RNA methylation	Interproscan
GO:0008168 all species →	Molecular Function	methyltransferase activity	Interproscan
GO:0008033 all species →	Biological Process	tRNA processing	Interproscan
GO:0008175 all species →	Molecular Function	tRNA methyltransferase activity	Interproscan
GO:0032259 all species →	Biological Process	methylation	Interproscan
GO:0002181 all species →	Biological Process	cytoplasmic translation	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008173 all species →	Molecular Function	RNA methyltransferase activity	Interproscan
GO:0030488 all species →	Biological Process	tRNA methylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for HSymV2.0_g08.12945_t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of HSymV2.0_g08.12945_t1 across 44 RNA-seq samples of Hydractinia symbiolongicarpus. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

44Samples

44TPM > 0

3Conditions

113.5Max TPM

72.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
Whole embryo	36	36	67.91	92.02
Whole embryo · Triptolide 20 uM	4	4	100.11	113.45
Whole embryo · DMSO 0.5%	4	4	83.67	94.54

Per sample · hover a bar for the full sample record

Show the sample table (44 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR24482167	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	92.02
SRR24482170	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	91.70
SRR24482168	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	90.41
SRR24482175	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	89.85
SRR24482165	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	87.47
SRR24482171	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	87.44
SRR24482161	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	86.57
SRR24482169	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	83.89
SRR24482142	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	83.63
SRR24482172	Whole embryo	Whole embryo	30 mpf	not recorded	SRP436676	81.42
SRR24482166	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	81.34
SRR24482163	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	80.76
SRR24482173	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	78.77
SRR24482174	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	78.69
SRR24482141	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	78.15
SRR24482145	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	77.74
SRR24482138	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	74.42
SRR24482140	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	74.29
SRR24482136	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	74.28
SRR24482134	Whole embryo	Whole embryo	5 hpf	not recorded	SRP436676	72.04
SRR24482143	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	71.90
SRR24482144	Whole embryo	Whole embryo	Unfertilized egg	not recorded	SRP436676	70.70
SRR24482162	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	69.99
SRR24482153	Whole embryo	Whole embryo	7 hpf	not recorded	SRP436676	69.82
SRR24482135	Whole embryo	Whole embryo	4 hpf	not recorded	SRP436676	69.29
SRR24482137	Whole embryo	Whole embryo	3 hpf	not recorded	SRP436676	68.76
SRR24482177	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	66.82
SRR24482139	Whole embryo	Whole embryo	2 hpf	not recorded	SRP436676	64.73
SRR24482176	Whole embryo	Whole embryo	1 hpf	not recorded	SRP436676	62.72
SRR24482133	Whole embryo	Whole embryo	6 hpf	not recorded	SRP436676	54.21
SRR24482160	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	25.77
SRR24482157	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	24.92
SRR24482158	Whole embryo	Whole embryo	48 hpf	not recorded	SRP436676	21.39
SRR24482159	Whole embryo	Whole embryo	24 hpf	not recorded	SRP436676	21.06
SRR24482156	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	19.61
SRR24482155	Whole embryo	Whole embryo	72 hpf	not recorded	SRP436676	18.06
SRR24482147	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	113.45
SRR24482146	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	106.51
SRR24482149	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	93.30
SRR24482150	Whole embryo · Triptolide 20 uM	Whole embryo	7 hpf	Triptolide 20 uM	SRP436676	87.19
SRR24482154	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	94.54
SRR24482148	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	90.94
SRR24482152	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	78.37
SRR24482151	Whole embryo · DMSO 0.5%	Whole embryo	7 hpf	DMSO 0.5%	SRP436676	70.82

Source: CnidoSite RNA-seq expression matrices (HSYMB_TPM, StringTie quantification over 44 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Hydractinia symbiolongicarpus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	37	HSymV2.0_g12.20751_t1	0.971968987306721
Negatively correlated	6	HSymV2.0_g02.03283_t1	-0.906689176720937

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Hydractinia symbiolongicarpus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →