Gene detail

Detailed information of KXJ06384.1 in Exaiptasia diaphana

Genomic Location: LJWW01000996.1:4518...11696
NR annotation: KXJ06384.1, Ankyrin repeat domain-containing protein 33B [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ06384.1

ATGGTTTTGCTTACAAACGCTGTTCGRGAGGGAAGGGCGCACCAAGTAAAGCTCCTCTTGAAGGCAGGAGTGAACGTCAACTTGGCGGACAAAGACGGACAGACAGCACTTATTCACTGTTGTTTTTTAGAAGATCCTAAAGTAAGAATGACAATATTGAAGTTGCTGGTGTCTTATGGATGTAACGCGTCTATAAGGGATAAGTACGGTCGTGGAATTGTCTCGTGGGCTTGTACTTTAGCAAGAGTCGATGTACTTTCTTACTTATTGAACGATACGAACATTGAACTTGACTTTAACAATGTCGATAACGATGGTAGTACTACTCTCCTTCTTGCTGTAATGTCTGGTTGCCTGGAAATGGTTCAAATGGTWTTAATAATGGTCTTAAAAACCAGTACCATGGGCCAGATYCATCGTAGTAACAACGCAGGAATGTGCCCGTTGCTAGCTGCTTTTAGTCGAGGAGATAAAAAGTGCGCTCGATTGTTGATTAAGGATGGGGGTTCTCCACTCTCAAGTGTCATCAAATACCTCCAAGAACAAGACGAGTTCGACCCACCTAAATCTCATCCATTTTATGATTTTATTACTAAGAGTCSTGACCCGGAAAGCGGGTTAGATAATCGTGGAGTCCTTTCCGAAAGGGATCTTTTACAATTTCTGTTTGCTAAAGATGACACATCGACTCGTGCAAACAAATCAAGAACGTCACTAAGCTTAAAGACAAAATCAAAGACTATGATCGATTTCTGCTCGACTAAATCTACGGTTGGTTTAATTACAAGGAATTCATGCGATCTTCCAGATATTACAGATAGCTCATCGGAAATTGATATGACATCTCAKTCTCTAGACGCAGGCTTAAAGATTTCTTTTAGAAAGTATTATTCAAGTCAAGAATCAGTGTTACAACTGTATGATCTTTACGCGCACCAGCTAACGCCTTCTTACAGGGAGGGTCTGCCCTTGAGAAGGTATAAGACACCAAGTCCTCCACCACCACCCCGAAAGGAATCTCGTTCTCACAGAAACAGTRTCCARTATGAGATGAAAGCGACCAAACGAGGTTCAATATCATCTAGTAGCGGTAGTTATGCATTGGAATCAGCATTTGACAGGCAAATGAGACAAAGGTACTCGCGCACCAATAGAGCTGCTAGTATGCAGGTTGCTAAGCTACCACCRATTCCTGTCCATCTAAGAAAACTAAAGAAAACCAAGTCTTCGACGTCACTTAAAGTCAAGTTTTTACTGGAATCTGGATCGGTGAATGTAAATGTAACGGATCACCATGGACAAACACCGTTAATGAAGGCAATTTTACTCAATGATAAAATGTATCACACAAGATACAAGATAGTTCGCCTTCTTCTTAAACACGGTGCTAAAGTAAACTTGACGGACAAGAGCGGGAAAACAGCTCTAATGTTGGCTGTCATTCGTGGGCAAAAAGACGTCGCCGAAAAGATACTTAAATGTTCTCTTATGGACATCGATTTGAATGCAGGAGACGACAAAGGTAATACAGCTTTGATTCATGCTGCGTTAGAAGGCCATGACACTATTACAAGCATGCTCATCGCTTCATTGAAAAGGTTCAGTCTTGACATTGACAAGAAAAATCACCGTGGACTTACTGCCATGCTAGCAGCACTACGAGGAGGAAGAGAGGACTGCGCTCGAGTCTTATACTTACAAGGAGATGCAAGCCTTACAATTAGGGATCCTGATAACTTTATGAACGCCTCTGAATGGGCTACYCATAATCAATTATTTGATTTCATAGAATTAATTGAGAAAACTAAGCAAGAAACTGCGCCATTAAACACTCAGAATTCAACATGTAATAGCGCTGATATGATTAGAACAGAGACACCGAGGCTAGARACACCACTGATGGACTATGAATGTACCTCGAGGCCTCAGTCGCCATGCGACGTCACCAACAGACCAGTCTCACGTAAAAGAAACAGTAGATTGACAGTTCCTCGAGTCATGAATAATCTCAAGAACCAAGAAGAACCAGTAACAATAGTAATAGATAACTCGAGAGTTCCATCTCCTAATGACTCGACTCAAGACAGTCGACAATTTCTTCAGCCAAGTKTTCCTGCTGCGAAGGAAAATGGAAGCATGGAATCGAGGTCAGAATCTTGCGTAAAATCCTCAAGATCACTTCTTTCATCAAGAAGGTCATCTGAACCTCGACTCGGTGTTAAAGCGGGCTCCCATCAGTCAAAACGATGTTCAAGTGCGAAAACAGAAATACAACGATTGCTTTCAATATACGGTGTTCAGAACTCATTGACTTATCGTAGAGGGTACGACCCAACCTCCCTTCCTCCAAGTGGAATGTGGCCGGATCCCAATGCAGTGAATATCACAGACTCTATCGATAATATCAGYATATTTGGAGAATCMGACTCTTTCGGTGAATCGCCATTTGGTTTTGCTCGACGATCAGCTCTTTCGAATGCTTCCTCTCAATCAAGACGAATGAGTGTTTTTGGTGCCAACCAGGGAAGGGAGGGGCGAAGAATGTCAATCATTGGACAAGGAAACGCTAATACCGATAGACGGACTTCCGTCCTAGGACGTAAATTCACTAGCGTTCAACCGCCKCCTCAGAGAAATTTGCTCGAGGCATTGGGACGAAAACCAGGCGAAAGGAGGATGTCCATTGCAGCTCGTCCTAACATCATGGAAAGGCCTACATTGAGAAGGAATAACACCACACAAATGAGTCCTCTAGTAGGCTGA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010612 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR050842 all species →	Family	Cul2-RING E3 Ligase Substrate-Recognition Fem-1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24173 all species →	ANKYRIN REPEAT CONTAINING	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K21415	ANKS6; ankyrin repeat and SAM domain-containing protein 6	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ06384.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

62TPM > 0

2Conditions

7.8Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	31	2.16	6.07
whole animal · symbiotic	36	31	2.50	7.82

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.07
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.99
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.83
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.75
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.18
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.00
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.88
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.85
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.85
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.83
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.64
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.61
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.58
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.50
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.42
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.41
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.40
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.22
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.19
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.18
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.05
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.90
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.82
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.80
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.79
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.78
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.70
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.67
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.50
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.24
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.18
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.82
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.13
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.91
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.80
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.67
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.64
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.62
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.46
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.23
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.20
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.15
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.10
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.96
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.96
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.85
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.82
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.80
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.75
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.62
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.58
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.35
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.30
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.22
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.17
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.12
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.89
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.81
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.73
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.63
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.57
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.23
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.