Gene detail

Detailed information of KXJ08238.1 in Exaiptasia diaphana

Genomic Location: LJWW01000579.1:58256...65417
NR annotation: KXJ08238.1, Nucleolar GTP-binding protein 1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ08238.1

ATGGTAATCAGTTGTTTCTTCCTTTTCACGTGCTGCCAGCAATCCAACATGGCGCACTACAACTTTAAAAAGATAACAGTCGTCCCTACATCGAAGGACTTCATTGACATCGTCCTTTCCAAGACACAACGGAAAACACCGACTGTTGTTCACAAGGGTTATAAAATCAGCCGAATTCGTGGCTTTTACCTGAGGAAAATCAAGTATACACAACAGAACTACCATGACAAGCTATCACARATTATCACAGATTTCCCCAGACTTGAGGATGTCCATCCATTCTATGCCGATTTGATGAATGTATTGTATGATAGAGATCATTACAAGTTAGCACTCGGACAGATAAATACAGCAAGAAATCTAATTGACAATGTTGCAAAAGATTATGTCAGATTAATGAAGTATGGGGATTCACAGTACAGATGCAAACAACTCAAAAGAGCTGCTCTGGGAAGAATGTGCACAATAATGAAAAGACAGAAGCAAAGCTTAGAATATTTAGAACAAGTAAGACAACATTTATCAAGATTGCCGTCAATAGATCCCAACACAAGAACTCTCTTGGTTTGCGGTTTTCCTAATGTTGGAAAGTCAAGCTTTATGAACAAAGTAACCAGGGCAGATGTCGAGGTGCARCCATATGCATTCACCACAAAATCTCTGTTTGTTGGTCACATGGATTACAAGTATTTGAGATGGCAGGTCATGGACACACCTGGGATACTTGATCATTCTTTGGAAGAAAGAAATACTATTGAAATGCAGGCCATCACAGCATTGGCTCACCTTCGAGCTGCAGTTCTCTACGTAGTCGACGTTTCTGAACAGTGTGGCCACACCCTTGAAGAACAAGTAGAGCTGTTTAACAACATTAAACCACTGTTTGCCAACAAGCCTTTGATTGTAGTTGTCAATAAAATTGACATTGTCAGACCTGAGGAACTCTCAGAGGAGAAACAAGAAACCTTAAAATCATTTGAGGGTGAAGCGACAACTATCATCCCAATGAGTACTTTAAGTGAAGAAGGCGTCATGAATGTCAAAAACGAGGCTTGTGAAAGACTTCTCGCACAGCGAGTCGAAGTGAAAATGAAGAGTAAGAAAGTAAACGATGTTATCAACAGACTTCATGTTGCCGTTCCAACACCTCGTGACAACAAGGCCAGACCACCATTCATTCCACAGGCTGTTTTGGACAAGAGAAATGCCATGCAAGTTGAAGGAGTCAAGAAGAAGAAGTTGGCAGTKGARCTGGAAAAAGAGTTGGCTGAGGAYTATTATCTTGATTTGCGTCAACACTGGGACTTGCATAAGGAGGAAGAAAAAGGAGATGTTATTCCCGAAATATTCCTTGGAAAGAATGTTGCGGACTACGTCGATCCTGATATCATGAAGAAACTTGAAGAATTGGAGAGAGAGGAAGAACTCAGAGAGAAGGCTGGCGTTTACGAYTCAGATTCGGAAGAAGAACTTGACTCTGAACAAGAAGAGATCAAAAACAAGGCAGCACAGATTCGAGAGAAAAGAGCTCTTATCGTAAAAGAACACCGAGATRATAAAGGAACCACAAACAGACCTATTATTCCTCGAGTATCTTTAGCCAAGGCCAAAGCAGCTCGATCAAGGCTAGAAGGTCGTCGAAAAGAAGTCGGGATGGATGATGAAGACATGGATGACATGGATGATGCAATGGAAGAGGACGATGATCCAATGTCTGGAGGCAGCAAACGATCTCGTTCCAAGACTCCTGCCAGTCGTAAACGAAGGAGGGAAGCTTCCAGTGTGGGTCGAAGTGCGTCACGCAGCGTGTCACGCCTTCCACGTGACCAATCTGGTCTATCGCATCCTGAGAAAAAGGCCAAAGCAAGGAAAATGGTGAAGACTTCACAGAGAAAGATGAATAGAATGGGCAAAGCTGGTGAAGCTGACAGAATGATTCGTACCAAGATGCCCAAACACTTGTTCAGTGGGAAAAGAAAATCAGGCAAAACTGCAAGRCGATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9BZE4	GTP-binding protein 4 OS=Homo sapiens OX=9606 GN=GTPBP4 PE=1 SV=3
Q99ME9	GTP-binding protein 4 OS=Mus musculus OX=10090 GN=Gtpbp4 PE=1 SV=3
Q99P77	GTP-binding protein 4 OS=Rattus norvegicus OX=10116 GN=Gtpbp4 PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004362 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17835 all species →	NOG1_N	NOG1 N-terminal helical domain	Domain	Interproscan
PF08155 all species →	NOGCT	NOGCT (NUC087) domain	Domain	Interproscan
PF06858 all species →	NOG1	Nucleolar GTP-binding protein 1 (NOG1)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006073 all species →	Domain	GTP binding domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR031167 all species →	Domain	OBG-type guanine nucleotide-binding (G) domain	Interproscan
IPR005225 all species →	Domain	Small GTP-binding protein domain	Interproscan
IPR041623 all species →	Domain	NOG1, N-terminal helical domain	Interproscan
IPR012973 all species →	Domain	NOG, C-terminal	Interproscan
IPR010674 all species →	Domain	Nucleolar GTP-binding protein 1, Rossman-fold domain	Interproscan
IPR024926 all species →	Family	Nucleolar GTP-binding protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45759 all species →	NUCLEOLAR GTP-BINDING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003924 all species →	Molecular Function	GTPase activity	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0042273 all species →	Biological Process	ribosomal large subunit biogenesis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06943	NOG1; nucleolar GTP-binding protein	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ08238.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

72TPM > 0

2Conditions

449.2Max TPM

331.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	36	318.67	446.57
whole animal · symbiotic	36	36	344.31	449.23

Per sample · hover a bar for the full sample record

Show the sample table (72 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	446.57
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	435.99
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	434.37
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	433.62
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	431.91
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	427.03
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	412.20
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	381.61
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	376.38
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	372.32
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	370.65
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	369.09
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	368.39
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	356.30
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	353.45
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	346.82
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	341.84
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	341.17
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	332.41
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	311.25
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	301.93
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	301.48
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	298.23
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	297.50
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	254.85
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	254.25
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	253.49
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	246.88
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	241.06
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	237.87
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	192.59
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	192.45
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	190.42
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	190.37
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	189.57
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	185.68
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	449.23
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	444.87
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	442.20
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	432.66
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	426.29
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	422.82
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	422.29
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	409.52
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	408.10
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	403.09
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	387.82
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	387.19
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	384.87
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	373.87
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	373.87
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	373.22
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	372.22
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	370.16
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	366.28
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	328.31
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	327.84
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	325.69
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	323.49
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	313.58
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	298.21
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	279.59
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	278.16
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	274.77
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	268.99
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	268.64
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	249.07
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	248.56
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	248.20
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	245.94
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	243.80
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	221.79

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Exaiptasia diaphana tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	27	KXJ21265.1	0.93256527455384
Negatively correlated	54	KXJ16478.1	-0.92589215460891

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Exaiptasia diaphana, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region
ChIP-seq	H3K9ac_symbiont	1	Promoter (<=1kb) 1

Browse the full epigenomic landscape of this species: ChIP-seq · ATAC-seq.

DNA methylation (bisulphite samples)

Sample	Methylation profile
whole_animal_aposymbiotic_1	open
whole_animal_aposymbiotic_2	open
whole_animal_aposymbiotic_3	open
whole_animal_aposymbiotic_4	open
whole_animal_aposymbiotic_5	open
whole_animal_aposymbiotic_6	open
whole_animal_aposymbiotic_7	open
whole_animal_aposymbiotic_8	open
whole_animal_aposymbiotic_9	open
whole_animal_symbiotic_1	open
whole_animal_symbiotic_10	open
whole_animal_symbiotic_11	open
whole_animal_symbiotic_12	open
whole_animal_symbiotic_13	open
whole_animal_symbiotic_14	open
whole_animal_symbiotic_2	open
whole_animal_symbiotic_3	open
whole_animal_symbiotic_4	open
whole_animal_symbiotic_5	open
whole_animal_symbiotic_6	open
whole_animal_symbiotic_7	open
whole_animal_symbiotic_8	open
whole_animal_symbiotic_9	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →