Gene detail

Detailed information of KXJ11138.1 in Exaiptasia diaphana

Genomic Location: LJWW01000380.1:96025...110445
NR annotation: XP_020906060.1, extended synaptotagmin-3 isoform X1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ11138.1

ATGGACACGGAGGAGAAAGATATGTCGGACAATGCAGAGCAAAAAGAACTTTCCCAGTCCCCGGCTTCGCTAGTAGATGCCACAAATCACTCTGCAGGACCTGGGAAGAAAGAGGGATCAGCGATTGATGTTGGTGTTGTGAAATTCGCCATCAAATATCTAAAGTTTGTTGGCGTTGCTCTCTGCATTTGGTTCATGGGTTGGCTAGGTTTGAGTTATGTATGGGTTCTTTGTGGACTATTGATTTATGTGGTTTGGAAGCTAAACAAAGAGGAAAGAGAGAGGAAGAAAACCGTTTTAAAAGAATCAGCAGAAATGGCAGCAGATGGTGCTGTGCCGCCAAGAATGGAAGACCTTCCTTCTTGGGTGTTTTTCCCAGATGTTGAAAGGGCAGAATGGCTGAACAAGATGATTGTACAAATGTGGCCCTATATCAATGATATGGTTGTCAAGATACTGAAAGAAACTGTTGAGCCAGAGATTCAGAAGAATGTCCCAGGATTTTTGAGCTCTATCCACTTTGCTGAACTTTCTCTTGGAAATCAGGCTCCACGAATTGGCGGGATCAAGACCTATACTCAGAATGTGAAACGATCTGAGATCATAATGGATGTTGATTTGATTTATGCTGGAGATGCCGACATCAAGCTATCAGTTAAAGGTGTATCTGTTGGCATTGAGGATTTACAGCTAAGAGGAACCTTGCGAGTTATTTTGAGCCCACTTGTGCCATCTTCACCATTGGTTGGTGGAGTGTCAGTGTTTTTCCTTAACAGACCAGATATTGATTTTGACTTGACAAATCTTCTTAACATACTGGACATCCCTGGACTGAGTGATATTTTAAGAGGAGTCATTGATGATGTCGTAGCGTCATTTGTAGTTTTGCCAAACAGAATCTCTGTTCCTTTGACTGATATTGATCCTTACAAGCTTAAATATCCACTGCCTGATGGAGTCCTTCGTATTCATGTACTGGAAGCTAAGGATTTGGTCAAAAGAGACATTGGTGTTTTTAAAAAAGGATCTTCTGATCCCTATGCCATTATTAAAGTTGGTGCACAGACATTCAGGACAGAAACTAAAGACGAGACCTTGAATCCCAAGTGGAATGAAGTATTTGAGGTGTTTGTAGAYAATTGCCAGGGTCAAAAGATCAGGATCCAGTTGTTTGATGAAGACAAAGCTTCTGATGATGAAACACTTGGTACAGTTGAAGCTGACATTAGTACTGTTGTTCAACAAGGTAGTGCTGATCTGTGGCTACCACTGGAGAATGTTGAGAGTGGACAAATAAATTTACGCTGTATTTGGTATACATTTACCAACAATCCTGATGACCTTTCTCCACCTGAGAAAGCTACACAGGGGGATGAGATGCTAGGAACGGCTGCTTTGTTTGTGAAACTCGACTCTGCCAAGAATCTCCCAGTTACAAACCCTGCTCGTGGTACTACCAGTGCATTCTGTAAGCTGACTGTGGGAAACAAGACACTTTGCAGCAAGACTATTCAAGACTCCATCAGTCCAGTCTGGGAAGAGCCATTYAGGTTTTTAATTCACGATCCCAAATATCAAGAGCTGGATTTTGAGGTGTTTGACAGTGTTAAAGAGAAGAGCATTGGCAAATTAGATGTTACACTTGACCGGTTGCTTAAAGATGAGGACATGACATTTGAACAACCTTTCCCACTCAAAGATTCTGGTCATAACAGTACCATTACATGTTCTCTCCAGCTCAAGTCCCTTGTTACTCGTGATGATGACACATCTGATGAGGAAGACGATGAAGAAGAAGGTGAGGCAGGTAAAGAAACTTCAGAGCTTATACCATCACAGGATGGAAAAGAGGGTGAAAGTAAACCAACAGCTGTGAGAAGGAGAAAGAAGCCAGCTCCAAAAGAAGAAATTAAAAGGAATGTGACTGGTGATCTTTATTTCAAAATTCATTATCTTTCCCAAGGAAGCAAGTTGATCGTAGAGCAAATGAAAGCCAGGGACTTGATGCCCTGTGACTCTGATGGTCTGGCTGATCCTTACATCAGAGCATACCTTCTCCCAGAGAGGTCAAGGAGCAGTAAAAGAAGAACAGATGTAGCCAAAAACACCTTGGCTCCCAGTTTTGATGAGCGTTTTGAGTGGATGATACCAGAAGATAAACTCAAAGACCACTCTTTGGAAATTTCTGTCAAAAATGATGTGGGATTCTTCTCAAAGAGCAAAACAAACATGGGAGATGTTATTGTTGATCTTGGTAAGATGGATGTGAGTAAACCTTCTGCTGAATGGCATATCCTCCATGACCCAAAGGAAGATGACTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5M7N9	Extended synaptotagmin-3 OS=Xenopus tropicalis OX=8364 GN=esyt3 PE=2 SV=1
Q5FWL4	Extended synaptotagmin-2-A OS=Xenopus laevis OX=8355 GN=esyt2-a PE=2 SV=1
Q3TZZ7	Extended synaptotagmin-2 OS=Mus musculus OX=10090 GN=Esyt2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001222 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00168 all species →	C2	C2 domain	Domain	Interproscan
PF17047 all species →	SMP_LBD	Synaptotagmin-like mitochondrial-lipid-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035892 all species →	Homologous_superfamily	C2 domain superfamily	Interproscan
IPR000008 all species →	Domain	C2 domain	Interproscan
IPR037749 all species →	Domain	Extended synaptotagmin, C2B domain	Interproscan
IPR031468 all species →	Domain	Synaptotagmin-like mitochondrial-lipid-binding domain	Interproscan
IPR051634 all species →	Family	Extended Synaptotagmin	Interproscan
IPR039010 all species →	Domain	Synaptotagmin, SMP domain	Interproscan
IPR037733 all species →	Domain	Extended synaptotagmin, C2A domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45761 all species →	EXTENDED SYNAPTOTAGMIN-LIKE PROTEIN 2, ISOFORM C	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006869 all species →	Biological Process	lipid transport	Interproscan
GO:0061817 all species →	Biological Process	endoplasmic reticulum-plasma membrane tethering	Interproscan
GO:0008289 all species →	Molecular Function	lipid binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005544 all species →	Molecular Function	calcium-dependent phospholipid binding	Interproscan
GO:0008429 all species →	Molecular Function	phosphatidylethanolamine binding	Interproscan
GO:0031210 all species →	Molecular Function	phosphatidylcholine binding	Interproscan
GO:0031227 all species →	Cellular Component	obsolete intrinsic component of endoplasmic reticulum membrane	Interproscan
GO:0031234 all species →	Cellular Component	extrinsic component of cytoplasmic side of plasma membrane	Interproscan
GO:0035091 all species →	Molecular Function	phosphatidylinositol binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ11138.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ11138.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

72TPM > 0

2Conditions

296.1Max TPM

175.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	36	161.92	288.44
whole animal · symbiotic	36	36	189.20	296.07

Per sample · hover a bar for the full sample record

Show the sample table (72 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	288.44
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	199.90
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	193.28
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	193.20
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	192.31
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	191.90
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	188.26
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	186.01
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	184.64
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	183.07
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	182.64
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	180.19
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	178.76
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	177.69
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	175.57
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	175.08
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	173.95
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	167.86
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	167.62
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	166.82
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	159.16
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	158.27
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	156.22
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	152.79
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	148.81
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	143.83
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	142.62
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	138.37
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	135.58
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	112.73
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	112.20
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	108.37
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	107.55
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	106.01
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	102.69
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	96.91
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	296.07
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	254.03
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	252.64
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	252.42
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	251.68
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	251.32
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	250.92
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	249.11
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	211.55
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	208.37
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	195.60
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	195.14
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	194.22
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	194.07
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	193.74
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	190.20
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	183.64
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	179.65
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	179.21
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	179.17
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	176.80
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	174.50
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	173.84
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	170.23
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	166.41
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	161.07
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	158.98
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	155.23
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	152.16
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	148.81
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	145.75
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	144.32
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	142.18
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	135.84
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	126.08
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	116.16

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Exaiptasia diaphana tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	20	KXJ20876.1	0.83623454331973
Negatively correlated	16	KXJ23429.1	-0.774110803709048

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Exaiptasia diaphana, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region
ChIP-seq	H3K27ac_symbiont	1	Promoter (<=1kb) 1
	H3K9ac_symbiont	1	Promoter (<=1kb) 1

Browse the full epigenomic landscape of this species: ChIP-seq · ATAC-seq.

DNA methylation (bisulphite samples)

Sample	Methylation profile
whole_animal_aposymbiotic_1	open
whole_animal_aposymbiotic_2	open
whole_animal_aposymbiotic_3	open
whole_animal_aposymbiotic_4	open
whole_animal_aposymbiotic_5	open
whole_animal_aposymbiotic_6	open
whole_animal_aposymbiotic_7	open
whole_animal_aposymbiotic_8	open
whole_animal_aposymbiotic_9	open
whole_animal_symbiotic_1	open
whole_animal_symbiotic_10	open
whole_animal_symbiotic_11	open
whole_animal_symbiotic_12	open
whole_animal_symbiotic_13	open
whole_animal_symbiotic_14	open
whole_animal_symbiotic_2	open
whole_animal_symbiotic_3	open
whole_animal_symbiotic_4	open
whole_animal_symbiotic_5	open
whole_animal_symbiotic_6	open
whole_animal_symbiotic_7	open
whole_animal_symbiotic_8	open
whole_animal_symbiotic_9	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →