Gene detail

Detailed information of KXJ13005.1 in Exaiptasia diaphana

Genomic Location: LJWW01000300.1:66013...81626
NR annotation: KXJ13005.1, Stage V sporulation protein K [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ13005.1

ATGAGTAACTCCGACAATGGCAGCACGGTCCTGATTGACGAATTAAGGGCATTCTTAGAAAGAAACGCGAGCAGAAGCAGCTCAGGCACAGTAGCATCAAATGTAGCTAGAGGTATGCGTGGTGATACCGCACTAAGTTCAAATATCAACCGCGTATTTGGAAGCTCTTCCAACTCTTCCAGCTCTCAACGACCAATCCTGCCTTCCGCAACAGCACCAACGGCACGCTATGCGCCATACCGTCCGAGGTCCACGAGGAACAAAGGTAAAAAGGTCAAAACGTACCACATAAAACTTGCAGTAGTGGATTTAATCAACGAAGTTCAAGAAAGAGGCTCGACTGAGGAATTTAATGGGCGTACACTTCTGGAGTCTCCATTCATGGTTAGCGAAAATGAGCAAAATAGAGAAATTCGTGAAAACGCTCTTAAAATAATAAGAGCGAGATATAAGGATTATGATGGAGATTTCAGTTACGCTATCAGAAGTTCTCGGCGATGTTTTAGCATAAGCCCAATTCAAGAACTTAGTGCTAAAGAGGTCTTGACTCTAAAAACAAAGTCAACTGGCATTTTGTACATAATGCTAAGCAAAAATGCAGAGCCYCCAGTACAAGATGAAGACTGCCATGAAGAAATTGAACATGAAGCCATAATACAAGAACCGGAGATACTTCACTCAACCCCTGTACGCTCCGAAGGTGGTCGAACGTTTAGAAGAAATCTTCGCAAAAGGCTAGCAGCAAGTACTGCACACGCTAGCGAATCAAGTGATTCCGAAGAAATATCCGATGGTGAAGAAAGCGAAAAAACTGATTTGCCAGAGTYATTGCTCTTTTTTGGGAGAGAAGCGAACATAAGACGGTCACACGAAAAAGAAGTCCTTGGATTTTACAACCCAGATGGCAAATCTTGTGGTTTGACTGCCATTCTTCTTTTACTGCTGCATGTCAAACCGTTCACAGCATTTGTGGAGAAAAGTCAAAGTCCCATATGCAGTTTAATTAAAGATATTTATCAGCTGAGAGGTCTGAGAGACAGAAGGATCTCCAAAGTCTTTGGAAATCTTTTGGAAATGCTGGCCTTACCAGTCGGTCGTATCGACTGCAATGAATTCTTATTGAAACTTTTTACGAGGCTCACTGAGGAAGAGGAGATGACATACCAAACTTTGAAAGAGAGATACCCAGAAGAAATAAGTGAAGCTATGTCGGCAGATGACTCGGGAGAAAATCCTCACTGTATATACAGACGTTATTATCAAACTCCTCCACAAGTGCTGATGCTGGGACTACAAAGGGGAACTACGGATATGCATCGAAAGGATAACCAGAACGTTATAATTCCAAGGGTAATTCCTTTTCTTGATTTAAAAAAGCCAGAGAACGAGGGCGTTCATTCCTCAACTGAATCGGGAGAGGGACAATACACCCTTTATGGAATGATAGTCCATTCTGAAAAAAGAGACCATAACTATGCCGTTGTAGATGTTGGGACGTCGAAATTAATTCTGTACGACAATTTAGACGTTTACGAGACAGAAAATACGGATTCAGTTCTGAGGCATCTGAGCGGGAGTGGCAGAGATGACTCTTCTGAACACAATAACCCGGGAATGGGAAAGAGACGCTGGAGATGTGAAGCCAACACAGGGGATGTGCCTATTATTGACATTGATCCGATGGATACGCCAGTTGACTATCAAGAAATGTTTTCAAAAATCGAAAACCAAACAAAGATGTTCGTGGGTCTGGACCTCCTGAAAGACCAGTTCCTCAAGTTTGCAAAAACAACCATTCTCCATGAGAAGAGGAAGCAGCTGGGATACAAAATGCAGGACGTGTGTAAAAACATGCACTTTGTCTTTCAAGGAAACCCTGGAACGGGGAAAACTACATTCGCTAGAAAGGTGGCAGATCTCCTTTACACACTAAAGCGAATAAAGAAAAAGAAGGTGGTGGAGGTGCAGAGGGGTGACCTGGTGGGGCAATTTCTGGGATCTACCGAGGCCAAATGTGAAGCAGTAATAAAATCCGCTAGAGGAGGGGTCTTATTTATTGACGAGGCCTACCGTTTGGCGTCCCGTAGCGAATCAGACTACGGGAGAATTGCAATCGATCAGCTGATGTCCTCTATGGAAGGAGGTAACCCGGTGATGATTTTCGCCGGGTACAAAATAGAAATGAGTGTGTTTGTTAAGGCAAACCCGGGACTAAGGTCACGGATTCGCTATTTCTTTGACTTTCCAGACTACTCCCTAGACGAACTGGATGAAATAATGAGAAACAAAATTGCAAGTAATGGATACCTATACGAGGGACGGCGGCTTGCTGAGATATTAAAAGAGCACACGTCTGAAGACATCAGGCAGCAGCNCTTATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P27643	Stage V sporulation protein K OS=Bacillus subtilis (strain 168) OX=224308 GN=spoVK PE=2 SV=3
P51228	Protein CfxQ homolog OS=Porphyra purpurea OX=2787 GN=cfxQ PE=3 SV=1
O78450	Protein CfxQ homolog OS=Guillardia theta OX=55529 GN=cfxQ PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001708 (this species only) · gene tree & orthology
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF00443 all species →	UCH	Ubiquitin carboxyl-terminal hydrolase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR050773 all species →	Family	CbxX/CfxQ RuBisCO activation and ESX secretion	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR000641 all species →	Family	CbxX/CfxQ	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR001394 all species →	Domain	Peptidase C19, ubiquitin carboxyl-terminal hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43392 all species →	AAA-TYPE ATPASE FAMILY PROTEIN / ANKYRIN REPEAT FAMILY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004843 all species →	Molecular Function	cysteine-type deubiquitinase activity	Interproscan
GO:0016579 all species →	Biological Process	protein deubiquitination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ13005.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ13005.1 across 72 RNA-seq samples of Exaiptasia diaphana. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

0TPM > 0

2Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	0	0.00	0.00
whole animal · symbiotic	36	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.