Gene detail

Detailed information of KXJ13962.1 in Exaiptasia diaphana

Genomic Location: LJWW01000268.1:55961...70796
NR annotation: XP_020900877.1, short transient receptor potential channel 4 isoform X1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ13962.1

ATGGATCATACGCCTTCCGATCTGGCTAACGGATTTGTCAGGCCATTTTGGGAAAACCAGGTTATAAAAGAAAATGGCCAACTTATGTCAAATGGTATTCCTCTTGGCGAAACCAATGTCACAAATCGACAATTTTCATCTTCAAAAGGGGATAGTTCAGAAGCGAATGAATTCTTACTTAATCATCAACAAAGGTTGGAAAACTCCATGGTGAATGCCGTGAGGGATAATAACTTTTTGGCTCTTGAGGTTACTCTTAATCATTACATAGAACTTTTAAACTTAGATGATTTTTGTGGTGAAAGTAATGCTATTGACGATTGTGAGACGCAGAGGCCGCAGAACTTTCTTCCCCTGGTTGTGGCTGCGCATCTTGGTAGCTATGAAGCTATCAATGTTTTTCTGTCTAAGGGATTCGAGCTTGAAAAACCACACGATGTTCTCTGTAAATGCGAGATTTGTCAGGAAGACTTATTCCGCGTTTCTCAAAAGCGCCTCGATATTTATCGTGCACTAGCAAACCCTGTTTATATTTCGATAACGTCCAGTGATCCGTTYATTACGACTTTTAAGTTAATCAATGAGCTACAAACTCTTGCTTTTCGCGAGGATGAGTATGAAAAAGACTACCTAGCATTGTCACAGCAATGTTGTCAGTTTTCGCTAGGTTTGTTGGACGAATGCCGAACATCTAGAGAACAGAATAGCATATTAAATTATCCTGGAATCGACGCTTCGGACGAAGAGTTTGCCGAGGGAAATCTTGGTTTAGTGAATTGTGCGATTTCATACAATCAAAAAGAGTTCGTTGCACACCCGTTCTGCCAACACCTCATTATGCAGCACATATTTGGGGACATCAGTAAATGGAGGACCAGCAGCTTTATGTACCGCGCCCTTTACGTCATCGCACAAGTAATAATATTCCCGGTTATGGCCTTCATGTATATTTTCTTTCCATTTCTTCCGTTCAGCCGTAAGATCAAGAGACCTTTGGTCAAATTCATCAATCATACAGCCTCGTTTATAGGGTTCTTGTGTCTATTGGCAGTATCATCGCATCATAAGTTCAAAATACGATTCCAAGAAACACCGTCCCTCCTGGAAACTTTTATCTTATTGTGGATACTTGGTATTGCCTGGTCAGAATGTATCCAGGTACATAACGATGGTCTCAAAAGATACTTAAGTAGCGGCTGGAATTGGATGGATATGGCCATGGTATTTTTCATTCTAGGCGCGTACATTCTCTGGTCTCTAATGATTGCATTTAACCTAAGTGAGCCTGAAACATTAYCCCATGACATCGTTCTMAGCGCCGCGGACGGTTTGTACTCGTTCGGTGTCGTTGCAAGTTTTTTTCGTCTCGTCTACTTGTGTCAGATCAGTCGATACCTTGGATTACTTCAGCTCAGCTTAAGCCGCATGGTTCGCGTCATTTTTCAGTTTGCGTTCATCAGCATTGTTATGCTTGTGTCTTTCTCTGTTGCTATGACAATGCTATATAGCGTGTCTTTTGAGGCATATGGTGGGGAGAGGCCTAAAGTGACTTACAACTCGACTATGAAACTCGAAAGCGTCTTGGATAAGGGATATCACAATCTGCTAACTACAATGGTTACACTGATGTGGGCTAGCCTAGACATGGTGGATCTTAATAGCCTCAATGTATTCAAAGGCCAAAGTTTAATTCAGTTCTGGACGGCAGCACTGTTTACACTCTACCATGCATCCTCTATGATTGTATTACTGAACATGCTCATTGCAATGATGAGCAATTCATATCAACAGGTTGAGGACAACATTGAAACTGAATACAAGTTTGCAAGGACACAGCTATGGGCAGATTATATTGGAGATAGCGTTCCYACATTGCCTCCTCCTCTAAACCTCCTTCCAACTCCTAAGTTCGTTCTCAAACAGTTTTCAAAAGTTACCTACAAGTTCTTTGGCATTCCTAAAACTGAGCCATGTTTTCCTGGGCATCGATTCAAAGTTTACGACGCAGCAAGAATGGATGCAGACCAAAAGAAACAAGAATATAAGAACACTGTGCGAGAGTTACTTCGACGTTATTGGGCAAGGCGGAGAAAAGAAAATCAACCTCAGCTGATCAACGACCAAAATCAGTTACTAGCTATGCACAACATCAAAGARGAGGTGTCCGACATGCTTAGCGAGATAAGAAACATTTTGAAGGCAAGAGGACGGGCAAAAAGTCGCGATCGTCTAGCGCGATTGGAGGAGATTTCGGAAAAGGAAACCGTTCGTGTAGAATTCCACAATCAAGTGATYTCTCCATCAATGACGAATAACAAGAAGCAATTARCTAACAAYCACATTGGAGAAATGACATCATCACCGAATGACATCATGGTACAGGACTCAAATCACAATACAACAGAAGAGGTTCCGTGGCCAGTCCAGGAGAGAAGCAACCATAAACCAACAATAGACTTGAAAGTGGAGACAACAAAACTATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9QUQ5	Short transient receptor potential channel 4 OS=Mus musculus OX=10090 GN=Trpc4 PE=1 SV=1
P79100	Short transient receptor potential channel 4 OS=Bos taurus OX=9913 GN=TRPC4 PE=2 SV=2
Q9UBN4	Short transient receptor potential channel 4 OS=Homo sapiens OX=9606 GN=TRPC4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005133 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08344 all species →	TRP_2	Transient receptor ion channel II	Family	Interproscan
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002153 all species →	Family	Transient receptor potential channel, canonical	Interproscan
IPR013555 all species →	Domain	Transient receptor ion channel domain	Interproscan
IPR005821 all species →	Domain	Ion transport domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10117 all species →	TRANSIENT RECEPTOR POTENTIAL CHANNEL	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005262 all species →	Molecular Function	calcium channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015279 all species →	Molecular Function	store-operated calcium channel activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0034703 all species →	Cellular Component	cation channel complex	Interproscan
GO:0051480 all species →	Biological Process	regulation of cytosolic calcium ion concentration	Interproscan
GO:0070588 all species →	Biological Process	calcium ion transmembrane transport	Interproscan
GO:0070679 all species →	Molecular Function	inositol 1,4,5 trisphosphate binding	Interproscan
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ13962.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ13962.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

64TPM > 0

2Conditions

22.4Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	9.09	17.28
whole animal · symbiotic	36	31	11.00	22.37

Per sample · hover a bar for the full sample record

Show the sample table (72 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.28
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.65
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.38
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.10
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.74
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.02
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.98
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.93
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.79
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.47
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.37
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.36
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.20
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.12
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.74
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.70
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.68
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.63
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.55
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.50
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.50
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.45
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.13
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.01
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.96
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.95
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.84
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.60
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.03
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.91
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.63
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.83
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.09
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.37
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.42
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.16
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.41
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.18
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.92
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.58
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.35
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.73
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.37
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.37
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.55
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.12
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.03
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.91
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.77
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.69
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.38
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.00
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.80
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.68
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.39
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.80
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.76
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.79
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.67
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.32
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.14
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.89
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.56
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.99
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Exaiptasia diaphana tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	28	KXJ13950.1	0.86242625224983
Negatively correlated	4	KXJ23792.1	-0.663385852553367

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Exaiptasia diaphana, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region
ChIP-seq	H3K9ac_symbiont	1	Promoter (<=1kb) 1

Browse the full epigenomic landscape of this species: ChIP-seq · ATAC-seq.

DNA methylation (bisulphite samples)

Sample	Methylation profile
whole_animal_aposymbiotic_1	open
whole_animal_aposymbiotic_2	open
whole_animal_aposymbiotic_3	open
whole_animal_aposymbiotic_4	open
whole_animal_aposymbiotic_5	open
whole_animal_aposymbiotic_6	open
whole_animal_aposymbiotic_7	open
whole_animal_aposymbiotic_8	open
whole_animal_aposymbiotic_9	open
whole_animal_symbiotic_1	open
whole_animal_symbiotic_10	open
whole_animal_symbiotic_11	open
whole_animal_symbiotic_12	open
whole_animal_symbiotic_13	open
whole_animal_symbiotic_14	open
whole_animal_symbiotic_2	open
whole_animal_symbiotic_3	open
whole_animal_symbiotic_4	open
whole_animal_symbiotic_5	open
whole_animal_symbiotic_6	open
whole_animal_symbiotic_7	open
whole_animal_symbiotic_8	open
whole_animal_symbiotic_9	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →