Gene detail

Detailed information of KXJ15917.1 in Exaiptasia diaphana

Genomic Location: LJWW01000210.1:339067...347062
NR annotation: XP_020897930.1, uncharacterized protein LOC110236732 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ15917.1

ATGGATTCTCACACCCCATTCTCACATGAACTGCGTACAAATTCAAAGGAAAGGACCGCAACCACTATCAACAAACCCAAGAAAAGTCGGTCGAAAGTTTGGGAAAAAGTTGCTTGGTTTACGAGAAAGACAAAAACTAGCAAAGACAGTAAATCAAACAGTTCACAAGAAACACAAAAAGAKTGTCCTAGCCCGTGTTTGAAACGAAGACAGTTTAACAAACTTGATGCTCGTGTGGTTGAACTCCGCGAAACTTCTTGCACTAGTCATTCTCAAAACATAAGCCCTAACATCGTTAAAGCAAAGTCCAAATCAGGAATTAGAAAAGCCAGAAGCTTTAACTATTTAAAAAGAAAGAAACTAGGACATCATAACGAAAATGCTGAGTGTAGCAAGAGCGATTTAATCGAGAATAATCCACCAGCTGAGATGGCAACAGGGACATTCTGCGACTTCGAGTCAACTAGAAGAAGGACATCTCGCACTAGTAGTGCAAGTTGCTGTAATTTATTAAATGAGATTACTAGAGAAGCTAACTTAAAACGTCAAGGTCAAGAAAAAGGCAACGCGAAGAGCTCGTTATCATTACCAATGAGTTTATTGTCAATAGGTGAAAATAGCTCAAGAGTATCATCCCAATCTAACTCACAATCACTCTTGCACGATCGCATGGGGCCAACATACAATAGCTGGCCAAGAAAAAAACGAAACTTTCGCTCAAACCATTACATTGAAGCCTTTTCTCCTCCTCAAAAGCAAAAACGTATGACGACTTTGCGAAAGACAGCGACTTTCAATGGTTTTGACAAATTGAGTGTTAATGAAGATAAAATGATAAATTACCATATCAAAAGCACACCCACYTTGGACTCTCAAGACAGCCARATTAGAAATCAAAATGGGTTAGATATAGGTGTTATCCACTTTTTCAAAAGTCCTAGTATATCAACTGTGAAAACTACTAATGAATCAGACTGCTCTGGAGTCAAGTGCGCTGTGGAAATTGTCCACCAATCTGAAAGAAACAMCCAGCATGATGACAGTGATGAATTTTACATGATGAATGCTCACTCAAGTTTATGTGAATTTTTTGAATCCAAAGACTGGAGTAATGAACAACTAGAATTATTTTCACATGAATTAAACTGCCCTAGTGATGAACTGTCTGAGCATTCTAATAGTATTATTGAACACAAGAAATCTACTTGTCCTTTTCCAGAAAGTCTAATTGAAAATCACTCAAAAAGACCTCTTGAAAATGAAACCTGTAGTCCAGAGGATGACCAGGAAAAGGCCATAAGCCTTGATGGTGTGTATCAGATTAAGCCTCACATTGTTGATGACAAAAAGATGAAGGTAGAGATACCATCGCACATCAAGCATTCCAGGCCAGAGAAACATTTAGAAGTTATTCAGGAAGTTTCTGATAGTATTGCTGAAGATAACAGCCTATATACTCGAATTTCCAGTAATGGTGGTACTATAGCTGATAGCAATGATGCGCAATGCACAACTGTCAATCAACAGGTGCACACTCTACCACCAAGCAGTAAACTTGTTGACGATTCAAGTCCATCTTATGGAATCCCTAGAATCAATGAGATTTCATTTGATGAATGTCTCCTACAAACCAATGAGACTTGCTCTCACCGAGACACCAATGAAGCTGTAGAATCTGTTAGCTGTTTTACAAGCGACAATGGATTGCAATATGATAATCTTGACGACAAATTGAGTCTTCCTGGATTCATTAGTGATGCTAATATGTTAGCAAACACAAACATTTCTACTGATATCAGTGTATACTGCATTAAAATTGAAGGCCAAGCAACTGACTTTTTAGAGAAGAAAGACGAGTATCAACATGTTTTACCACAAAAAACGATTACAGTACATGCAGAAAATGGCAATATTGAGTCYTTAAAACAARGTGAAAATACAGAGGAAAGCAACTTTGAAAATATAAGCAATTTATCAGCAGTAAATAATTATAACCTGAAAGACTTGGATAATTCCTTGTTACCTTCACTAGAAGAAGAAGAAGAACCCAAAGAGGCTAATCTACCTCATTGTTCATATTCTGACAGTTCAAGCTGCAAGGAGTTGGATTTCAAGGACTGTTTTGACATATCTAGTGAACAATTCACTAGTCAAGCAATTTTGAAACAAAAGATACCCAAAGTTGATGGACAGAAATTTAAACAAGATACAGAGATAATGCTTGATTGGTTTTCCAACTTCAACAATGAGCAGAAGAACATCTTTGTCCGAAGGCTTCTGGAAAAATGTGAACTTCCACAAATGCACATGCTGTCAGTCATAATGGAGTCTGCACTACACAAGACCTGTCCATCAAACTGTCAAGACATGCTAGCATGGCTACCGCATCCTGTTACAGAGAAAATCCTATCTTTTCTTGATCCAGTGAGTTTGTGCCAGTGCAGTCAAGTAAACAAGCTATGGAACAATTTAGCCAGTAATCAAGTATTATGGAAAGGACTCTGCAGGAGCAATGAATGGCAGCTTTCTAGAAATGCAGCAAAGAAGCAGAATGCAAAATATACTCTTCCATCAGGGATTATTCAGTGGAAAAAGATGTTTGCTGAGCGATTTCTTCTTCGGAGAAAGTGGTTGAATGGACGATGCAGAGTGAGGACATTTGAAGGTCACACACAAGGGATATCATGTGTACAGTTTGATGATACACGCATAGTTAGCGGTTCTAGCGACAAGACAATAAAGGTCTGGGACCTGAGTCTAGATGATGGCCATGCAGTCCTTACTCTTGCTGGGCATTCTGGGACTGTTCGGTGCTTGAACTTAAATGGAAACAGACTTGTTAGTGGATCAGTTGATAAGTCAATTAAGGTATGGGATTTATCGTTTGAGTCTTATTGGAGTGGAGCATCTTGTAAAGTAACAATGATTGGTCACATGCACACTGTGAGATGTCTSCAAGTCGATGACCAGAAGGTTGTTAGTGGTTCATATGATAAAACATTAAAAGTCTGGGATATWAAGACAGGACATTGTAAACTWACACTAAGAGGTCACAATGCAGCAGTTTTGTGTGTTCAGTTTGACGACACTAAGATTGTATCTGGTTCTTATGATAACACTATCAAGGTTTGGAGTCTACAGGAAGGAGAATGCTTAATGACGTTGACAGGACATCATGATGCCGTGACGTGTCTTAATCTTACCCAGGATGGTAGGAAGGTCATTAGTGGGTCATTGGATCACAATCTGAAGTTCTGGGACTTGGCAACTGGGAGGTGTATTGGTACACTTGACTGGATCAGATCTGAAGGTCACACTGGTGTTATCAGGTGTTTGCAGTCTGATAGCTGGCGAATTGTTAGTGCAGGGGATGACAAGACACTCAAGATGTGGAGTTTAGAGACTGGTCAGCGACTGCTTACATTACGTTGTCATACAGATGGRGTGACYTGTCTCCAGTTTAATGATTACATGATTGTATCAGGATCCTATGARAAAACRGTCAAAGTGTGGAGCTTTACACCTGAACATGAATTCCTTAATTCATCATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B6Q4Z5	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333) OX=441960 GN=sconB PE=3 SV=1
B8M7Q5	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006) OX=441959 GN=sconB PE=3 SV=1
Q00659	Probable E3 ubiquitin ligase complex SCF subunit sconB OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) OX=227321 GN=sconB PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007597 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12937 all species →	F-box-like	F-box-like	Domain	Interproscan
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR001810 all species →	Domain	F-box domain	Interproscan
IPR036047 all species →	Homologous_superfamily	F-box-like domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19849 all species →	PHOSPHOLIPASE A-2-ACTIVATING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10260	FBXW7, SEL10; F-box and WD-40 domain protein 7	-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ15917.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

66TPM > 0

2Conditions

43.7Max TPM

20.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	19.07	39.13
whole animal · symbiotic	36	33	21.77	43.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.13
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.78
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.71
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.96
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.62
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.39
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.44
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.82
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.47
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.23
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.71
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.38
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.79
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.75
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.60
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.63
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.39
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.32
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.10
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.65
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.63
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.00
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.96
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.46
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.26
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.82
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.63
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.36
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.00
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.38
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.36
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.68
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.92
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	43.69
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.40
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.44
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.41
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.74
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.63
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.53
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.52
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.02
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.00
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.67
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.05
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.77
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.44
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.35
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.34
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.94
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.24
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.14
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.97
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.45
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.24
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.22
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.11
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.04
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.72
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.16
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.78
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.91
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.39
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.05
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.29
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.04
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.