Gene detail

Detailed information of KXJ16640.1 in Exaiptasia diaphana

Genomic Location: LJWW01000192.1:1...14276
NR annotation: KXJ16640.1, NADPH-dependent diflavin oxidoreductase 1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ16640.1

ATGTATTTCTTTCAAAGTCTCCACACAGCAGCCAACTATCTGTTTATTAGTTTAGCGATAGTGAACTTGACCCTGGGGACTGTTAGCGTACTTTCAAGCTCCATCTACAATATGGTGTTCTTTGAATGTACAAAGATGGCATGCTTGCTTAAAAACCTTTACATCATGTCCGCTGGATTGAATATGTCAGTGACGATGACAACATTCATGATAATCAGCGTTGAGAGATATATCTGTATTTTTTACGCCCTTCGTTGGGCAGAAATCGTCACAAAGAAGAGAGTTGTCATCATCGTTGGTTTGGTTTGGGTATTCTGGACAAGCATGGTTGTTATCATTCGTGCAATGAATCTCTGGGAAACATACGAACGGATATATATCATCCAGTTCGCCATCAACATTGCCATCAGTTGTGTTGTGAACACGAAAATCTTCAAAGAAGTCAGGCGACACGAGCACCGGATCGCTGCTCAAGAGCACGTCGTTGCTAACTCCGATGAGATTCGTAGAGTACGCGAGAAAAAGCGCGCGAAAACATTCATCTTGATGATTGCCCTTATCATCATGTGTTACGTTCCAACTCTAATCATGGTATCTCTWATGCATTTAAGTTCTATTAGTCAAAGTCAGATCCAAATTGGATGGATKATATGCCGAGTTATTTATCTCAGCCACTGTACTTTTGACTTACTCGTGTATGATCCATTTTATATGACGCCCGCGGTATATATTGCCAGCGGTATATCATTCAAGATGGCGGACGACAAGAGAGTTTTAACTGTTCTTTTCGGTTCGCAAACAGGGACAGCAGAGGACGTTGCTGAAAGGATTGGACGTGAAGGAAAGCGACATTATTTGTCTGTCTGTGTTAGAGCTTTAGATGATTATGATGTGACGAAGCTTATCCAAGAGAAAATTGTAGTATTTGTTTGTGCCACCACAGGACAAGGTGATGAACCAGATAACATGAAGAAATTCTGGAGATTTATAATGCAAAGAAACCTACCAACCAACTCACTAAACCAGCTCAAGTTCTGTGTTCTTGGACTGGGTGATTCATCATATGCAAAATTTAACTTCATAGCTAAAAAGATCCAAAAAAGATTAGTCCAACTGGGAGGTACATCATTGATCTCTTTGGGTTTGGCTGATGACCAGCATGAACTAGGTGCTGATGCTGTTATTGATCCTTGGTTAAAAGAGTTATGGCAGAATGTCCTACAAATCTACCCACTACCACTGGGAAAGGAGATTATTAGTGATGCAATAAGACCTCCTTCAAGGTACAGAGTTTCATTTGTTGAAAGTGAATTTAATGTTTCTCTACAAGACGACAATTCAAAAGTTCCACAACATGTCGATAAACATCATCCATTCCATGCAAAATTGATATCCAATGAGCGAGTGACAGCTACAGATCACTGGCAAGATGTACGTCTTGTTCGTCTTGATACAACTAACTCCAATATCATATATAGTCCTGGTGATGTTGTTATGATTCAGCCAAGCAATTTACAAGAAAATGTCGAAGAATTCATTAATTACTTAAAACTGGATCCAAACAGGGTATTCTCGCTAGAGCAGAACGACCCAGATATTCTCCTACCCAATGGTCTGCCAAGCCCCTGCTCGATAAGGTACCTTGTGGAACACTATTTCGACATACAGGGCACACCCAGGCGGTATTTCTTTGAACTCTTGTCACACTTTACAACATCAGAACTTGAAAGAGAAAAGCTGCAAGAATTCAATTCAACCGAGGGTCAGGAAGAACTTTATTCATATTGCTACAGACAGAAAAGATCAATGCTGGAGGTTCTCCAAGACTTCCCACACGCCAGTGCAAACCTTCCATTTGAGTACTTATTTGACGTCATACCCCCCATKAAGCCTAGAGCTTTCTCCATCGCCTCATCAATGCTGGCGCATCCCAATGAAATACAAATATTAATGGCGGTCGTGCAGTATAAAACCAAGTTAGCTAAACCGCGTCGTGGTCTGTGTTCTACATGGCTATCGTCCTTAGATCCATCTAATAATCACCTTATTCCTGTATGGGTTACCAAAGGCACGATATCGCCACCTAAAGATAGCAATATACCAATGATTATGATAGGGCCTGGAACAGGAGTTGCCCCTTTTAGAAGCTTTATTGAAGAACGAATAAGTCAAGGCTGTACAGCTGGTGTTCTGTTCTTCGGGGCACGAAACCGCTGTAAAGATTATTTCTTTGAGGAACAATGGAATGACTTAAGCAAACGAGAGGTGTTAACTGTGTTTACTGCTTTTTCAAGAGATCAGGAGGAGAAAGTCTACGTCCAGCATGCTATGAGAGCCAACAGTTGGTTAATATGGGATATGCTTAGTAATAAAAAGGCATCGTGTTACATAGCAGGAAATTCCAAGCGTATGCCCATCGACGTCACAGAGGCCCTCATTGAAATCATCGGTAAAGAAGGAAAAATGGATCTACCAAACGCACACAATTATATGAAGTACCTTGAGCAATCCAGACGATTTCAATGTGAAACTTGGTCGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NRG5	NADPH-dependent diflavin oxidoreductase 1 OS=Xenopus laevis OX=8355 GN=ndor1 PE=2 SV=1
Q9UHB4	NADPH-dependent diflavin oxidoreductase 1 OS=Homo sapiens OX=9606 GN=NDOR1 PE=1 SV=1
Q1JPJ0	NADPH-dependent diflavin oxidoreductase 1 OS=Bos taurus OX=9913 GN=NDOR1 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001660 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00258 all species →	Flavodoxin_1	Flavodoxin	Domain	Interproscan
PF00001 all species →	7tm_1	7 transmembrane receptor (rhodopsin family)	Family	Interproscan
PF00667 all species →	FAD_binding_1	FAD binding domain	Domain	Interproscan
PF00175 all species →	NAD_binding_1	Oxidoreductase NAD-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017938 all species →	Homologous_superfamily	Riboflavin synthase-like beta-barrel	Interproscan
IPR039261 all species →	Homologous_superfamily	Ferredoxin-NADP reductase (FNR), nucleotide-binding domain	Interproscan
IPR008254 all species →	Domain	Flavodoxin/nitric oxide synthase	Interproscan
IPR028879 all species →	Family	NADPH-dependent diflavin oxidoreductase 1	Interproscan
IPR001709 all species →	Domain	Flavoprotein pyridine nucleotide cytochrome reductase	Interproscan
IPR001094 all species →	Domain	Flavodoxin-like	Interproscan
IPR017927 all species →	Domain	FAD-binding domain, ferredoxin reductase-type	Interproscan
IPR029039 all species →	Homologous_superfamily	Flavoprotein-like superfamily	Interproscan
IPR017452 all species →	Domain	GPCR, rhodopsin-like, 7TM	Interproscan
IPR000276 all species →	Family	G protein-coupled receptor, rhodopsin-like	Interproscan
IPR023173 all species →	Homologous_superfamily	NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain superfamily	Interproscan
IPR003097 all species →	Domain	Sulfite reductase [NADPH] flavoprotein alpha-component-like, FAD-binding	Interproscan
IPR001433 all species →	Domain	Oxidoreductase FAD/NAD(P)-binding	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19384 all species →	NITRIC OXIDE SYNTHASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0010181 all species →	Molecular Function	FMN binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0003958 all species →	Molecular Function	NADPH-hemoprotein reductase activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ16640.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ16640.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

64TPM > 0

2Conditions

24.6Max TPM

7.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	31	7.59	12.54
whole animal · symbiotic	36	33	7.94	24.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.54
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.16
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.44
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.24
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.85
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.69
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.62
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.54
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.33
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.08
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.99
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.74
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.58
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.38
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.19
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.06
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.73
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.10
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.89
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.77
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.64
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.55
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.44
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.11
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.94
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.79
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.50
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.22
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.21
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.20
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.56
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.63
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.03
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.87
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.98
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.68
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.58
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.44
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.40
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.30
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.19
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.12
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.08
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.60
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.45
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.32
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.31
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.10
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.07
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.06
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.95
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.87
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.63
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.57
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.56
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.33
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.89
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.64
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.60
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.90
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.75
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.61
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.26
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.15
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.