Gene detail

Detailed information of KXJ17606.1 in Exaiptasia diaphana

Genomic Location: LJWW01000170.1:46...13755
NR annotation: KXJ17606.1, Superkiller viralicidic activity 2-like 2, partial [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ17606.1

GAATATCCATTTATCCTGGATCCCTTTCAAAAAGAAGCWCTCAAGTGTCTASAAAACAATCAATCAGTGCTTGTGTCTGCTCATACATCAGCAGGAAAGACAGTTGTTGCAGAATATGCTATTGCAATGTCCTTAAAGAACAAACAAAGAGTAATCTACACAACGCCTATCAAGGCTCTTAGCAACCAAAAGTAYCGTGAATTATATGAAGAGTTCCAAGATGTTGGTCTGATGACAGGTGAYGTGACCATCAACCCATCWGCTAGTGCACTTGTCATGACTACTGAGATTCTTAGGAGTATGCTGTATAGAGGCTCAGAGGTCATGAGGGAGGTGGCCTGGGTTGTTTTTGATGAAATCCATTACATGAGAGATAAAGAGCGTGGTGTTGTGTGGGAAGAGACCATCATCCTTCTCCCTGATAATGTCCACTACGTGTTCCTGTCTGCCACTATTCCCAATGCACGGCAGTTTGCAGAGTGGATAACGCATCTCCATAAGCAGCCGTGCCACGTTGTGTACACTGATTTCCGTCCTACACCACTTCAACATTATGTCTATCCTTCTGGAGGAGATGGTTTGTTCCTTGTTGTTGATGAAAAGGGTGATTTTCGTGAGGAGAATTTCAACAAAGCCATTGCAGTTATAAGAGATGGAGGAACAGATCCTGGTTCATTAAAAGGACGCAAAGGAGGGACCAAAGGTCCATCAAACACATTCAAGATTGTCAAGATGATTATGGAGAGAAACTTTCAGCCTGTTATCATCTTCAGCTTCAGCAAAAAAGAGTGTGAAGCTTACGCACTGCAGATGTCCAAACTGGACTTCAACACAACGCAAGAGAAAGGATTGGTAGAAGAAGTGTTCAACAATGCCATAGACTGTTTATCCGACGATGACAAGAAACTACCTCAAGTTGAACATGTTCTTCCCTTACTGAAGAGAGGGATTGGTATCCACCATTCTGGACTTCTACCCATCTTGAAAGAGACTATCGAGATTCTATTTGCTGAAGGACTTATCAAGGCACTGTTTGCTACAGAGACGTTTGCTTTGGGTCTCAACATGCCGGCAAGAACGGTTGTCTTCTCAAGCTCACGAAAATTCGATGGAAAAGATTTTAGATTTATAACATCTGGTGAATACATTCAAATGAGTGGACGAGCAGGGCGAAGAGGTCTGGATGAAAGAGGCATCGTTATTCTGATTGTMGATGAAAAAATGGGWCCYGATGTTGGGAAAAGTCTACTCAAGGGCCACGCAGATCCGCTGAACAGTGCTTTCCATCTTACGTACAATATGGTCCTGAATCTGCTTCGTGTTGAGGAAATCAACCCTGAAATAATGCTGGAGAAATCTTTCTATCAATTTCAAAACTATTCTGCCATCCCTGACATGATTGAAAAAATCAAGAAACTTGAAAAACAGAGAGATGAATTTGAAATCCCAAACGAGGAGTCGATCACAGCGTACTACAAGATACGACAACAGTTGAAGAAACTAGGAGACGACATGTTGGCGTTCATCCATCAGCCAAAGTATTGCCTTCCGTTTATGCAACCAGGACGACTTGTAAAGATTCAAAATAGGGACGTGGACTTTGGATGGGGTGTGGTACTCAATTTCCAGAAAAAAGCAAACCAAAAGAGCGGAGGACCAATAAGTGATGCGATATATGTGTTAGAAGTTCTTGTAAAATGTTCAAGTAAAAGGATTCGGTCTGCAGATGGTGAGATGCCGCAGCCATGCGGTCCTGATGAGAAAGGGGAGATGCAGGTCGTGCCTGTTTTATTACATCTTGTTAAACGGCTCAGCAGTGTGAGATTATATATTCCTAAAGATTTGCGATCACCTGATAGCAGACAAAGTGTTGGTAAATCGATACAGGAGGTTTCTAAGCGGTTTCCTGATGGCTTACCGTTATTAGATCCTATTGAAGATATGGGAATCAAAGATGATGGCTTGAAAAAAATTATAAGGAAAATAGAAATGCTTGAACATCGAATGTACTCACATCCACTTCATAAGGACGCCTCTCTCGACTCGCTATATAAGCTATGTGAAGAAAAAGCACAGATCATCGACAAAGCAAAGACCGCACGAAAAGAACTTAAAAAAGCCAGGACGATATTACAACTGGATGAACTAAAATGTCGAAAAAGAGTCTTAAGAAGGCTGGGTTATTCTACTGCAGCTGATGTTATCGAGCTAAAAGGCCGTGTAGCATGTGAACTCAGCAGAAAAAAAGAATTGCTGCGGCAAATGTGCCAAGCTGCCAAAGCCAAAAAAAATACTGAATTAGAAAATAAATTTGCTGAAGGCATCATTAAAATCAAGCGAGATAAAAAAAATGCTGCAAGTTTATATCTGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P42285	Exosome RNA helicase MTR4 OS=Homo sapiens OX=9606 GN=MTREX PE=1 SV=3
Q9CZU3	Exosome RNA helicase MTR4 OS=Mus musculus OX=10090 GN=Mtrex PE=1 SV=1
O14232	ATP-dependent RNA helicase mtr4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=mtr4 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001225 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13234 all species →	MTR4_beta-barrel	Mtr4-like, beta-barrel domain	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF21408 all species →	MTR4-like_stalk	Exosome RNA helicase MTR4-like, stalk	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR025696 all species →	Domain	Exosome RNA helicase MTR4-like, beta-barrel domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR048392 all species →	Domain	Exosome RNA helicase MTR4-like, stalk	Interproscan
IPR050699 all species →	Family	RNA/DNA Helicase	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan
IPR016438 all species →	Family	ATP-dependent RNA helicase SKI2-like	Interproscan
IPR012961 all species →	Domain	ATP-dependent RNA helicase Ski2/MTR4, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12131 all species →	ATP-DEPENDENT RNA AND DNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000460 all species →	Biological Process	maturation of 5.8S rRNA	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006401 all species →	Biological Process	RNA catabolic process	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12598	MTR4, SKIV2L2; ATP-dependent RNA helicase DOB1	EC:5.6.2.6	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ17606.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

60TPM > 0

2Conditions

10.4Max TPM

5.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	30	4.12	7.94
whole animal · symbiotic	36	30	5.80	10.40

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.94
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.81
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.48
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.30
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.44
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.05
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.65
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.50
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.48
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.38
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.36
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.34
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.22
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.16
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.09
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.83
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.76
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.64
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.60
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.34
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.30
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.92
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.89
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.73
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.66
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.49
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.04
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.00
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.92
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.93
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.40
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.91
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.44
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.97
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.61
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.57
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.33
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.14
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.03
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.80
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.16
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.14
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.95
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.72
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.56
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.44
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.38
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.30
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.22
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.08
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.07
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.04
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.95
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.78
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.53
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.49
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.48
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.47
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.00
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.97
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.