Gene detail

Detailed information of KXJ19782.1 in Exaiptasia diaphana

Genomic Location: LJWW01000124.1:279074...285602
NR annotation: KXJ06338.1, Espin [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ19782.1

ATGGCCGAAGAGGCAGAGAAAGTTCTTTCCGCCGCTCGAGATGGAGATATCAAGGCGCTACAGTCTTTTAGGCGATCTGTTCCCTTCGCGACGGATAGTTTTGGCGCAACAGCCCTTCACCATGCAACTCGACATGGCAAACTTGAATGCGTTCGATGGATGGTCGAGAAAGTCGGAATGAAGGCAAARGTTAAGGCAAATAATGGSGCTAYACCGCTTCACGATGCSTGTACACAAGGCAAGCTTTTGTGCGTCAAGTTYTTCGTACAAGAATGCCARTTGAATCCYGATGTTWSYGATAACTCGGGGCACACACCACTTCATTTAGCGGCTCGTTTTGGTTATGTAGACATTGTAAAATGGATGATTAACAAAGCTAAGTCCAACCCGAGATTGAAGACGATGAACCGAATGAATACAGTTCACTTCGCTGCAGCGGGTGGTCACCTGAGTTGCTTGGAGTTTCTTATCTCCAGCGGGAACACGATACTCTTAGACGAGAGAGCTACAGATGGCACAACGCCAATCTTCATCGCGTCACAGAATGGACACTTCCCATGCCTTAAGTACTTGCACACAGTTGGAGMAAAGTGTGAGTTAAGAAGTCGAGACGGAATGCATTTGATTCATGCCGCTGCACAGAATGGGCATTTAGATTGCATAGGATACTTGGTTGYTAATGGTCTTGCTAGTGAAACGGAGGGAGACAGTACTGGAGCAACACCAGCGCACTATGCTTCAGGAGAAGGGCATGTTAATGTACTAAAGTGGCTGAGCAAACGTTGTGATCTTAACATTAAAGATCARCTAGGAGGAACGCCTTTGCACGATGCTTCTGAAAAAGGACAATTGTCGGCCATCCAGTTTCTTGTAGAGAATGGTAACTTGAACGCAAAGCTGAAGGACAACAGTGGCCTGACTCCTATTGATTTAGCGGAAAAGTATGGCCACAAGAGATGTCTTGATTATCTTAGAGAAGCGTCTTTAAAGGCCAACCAAGTCCGAGCAGCRAAGTTGATGTCTTATACTMACACGTTTGACAAACAATCAGTCGAGGACAAATCCGGCTCTTCTTTCCTCCATGTACTTAAAAAGAAACCAAGACAGATGGATCGACCTTCTTCCCCAAAATCTGCCAAGGCGCCCGATGTTCCACCACTGGATTTAAGTCCCGAACCTTCTCCGAGGAACACCCCGATTCCATGCATGATAGAGTTYGGAAAAGCTTCGGAATGGCAAAAAATGGCCGTTGAAGATGTAGCGAAGGAGTTTCCGCACACTGCCGAGGTCAATCATTCCGTTGAAGACCAAGTAATCCAGAGAGAACACATTTTGGTTTCCAACGGTGCGAAATCATTGGCTCCCTTAAACGAGGAATTCTGGAAGAATARAAATAGAAACGCGACACCCACGCGAGACGTAGATGCGTACACGCAAAACGCGGAGGATGCGCGTCGTTTTGACCACCACCCAAGTGAGGAACTAACATCTGAATTGCTGGAAGCCGCAAAACTTCGTACTCAAATTATGARCGCGAGGATGCAGAATCCTACCCCATCCCCCCTTCACATGTTCGATGATAGAAGCGAGGAGACTGAGGCAAGGATGGTCGAGGAATTTTCATCACAGATCCAGGCCGCGCGTGCTAAGCGATCGCCTCATAGCACGTTGAATAAGAGTGATTACGAAGTCATAAAAACTGTAGAAATAGAAAATGAAAACATGGGAGAAAATAATGAGAATAATGAGAAACCCATGGAACTTAGTGATGCTAGCAAGTCCACGTTCGAAGATCAAATGTTGAATCGTTCAGTAGAGTCGCCAGACCAGCCAGTTGCCATGAACTCCTCTCCTTCAGCTCCAAAAACTCTAACGGATATTTTTGCCAACAGCACTCGAGATCCAAGTCCGGAACCTGAGAAAGGCCCACCCGAAAACTCGCAGGTGAGTCACGATACGTCATCACCGCCGAAACTGGACGACACACCTGTAACAAGGGCTGCTGAACCAAAGGAGTCACCGAAGGCCCCTTCTCCACCACCTAAAGTAGACGAGGGTTTTCTTYCCAAGTCAAATCAAGTGAAATTACCTTCTCCACCGCCACCTCATGAAGTAAAGGATACCAGTCCTTCGCCTGCACCACCACAAAAGAAAGGGTCACCTAMACCACCACAGCAAGCTGATAAACAGCCCAGTCCACAAGTGGAGCCACCTCGTGGATATCCACCTCAAAAGAACTCGAACTTAYATTCAGCGACTCCCCTTGTGCAACCGTCAAAAGGCACATCGATGGCAGATCCTCCAGATATGCCAGGGACAAGTMCCACTGAAGAAGATGAACACAAAATAGACGAAAATGAGCAACACATTGACGAGGAGAATTACATGACAACTGATGAAGAGACAGAAAAAACGGCAAGTTTGCCACGACCAGAAAARAGTGCAGACGATAAGGTCCCGCTACGTCAGAGACAACTGCAGCCGCTGCCTCATATGACCGGAATGGAAACCACAAAGAAAAGTCATCAAGAAGCAATCGATCAAGAAACATGGGCAACATTGCCAGAATGGAAGCGTCAAGTACTGAGAAACCGTATTATGAAAGAGCAACAGACAGARTTACATCTACGAAAGCAAGAGGAAGAGGAGAGGAAAAAATACGCAGGCATACCTGCCTGGAAAGTACCCATCATGCAACGCGAAGAATCCGACAGGAAAAACCGGGAAGAGAAACTGGCACACCTTCCTGACTGGAAAAGACAACTGATCCTCAGAAAGCGAGCAAAGATAATGAATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6ZVH7	Espin-like protein OS=Homo sapiens OX=9606 GN=ESPNL PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007615 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF13637 all species →	Ank_4	Ankyrin repeats (many copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR050842 all species →	Family	Cul2-RING E3 Ligase Substrate-Recognition Fem-1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24173 all species →	ANKYRIN REPEAT CONTAINING	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24047	ESPN; espin	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ19782.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

66TPM > 0

2Conditions

40.9Max TPM

5.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	6.15	40.94
whole animal · symbiotic	36	32	4.54	9.35

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	40.94
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.02
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.69
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.91
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.79
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.32
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.16
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.13
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.79
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.67
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.33
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.31
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.25
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.17
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.00
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.90
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.88
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.75
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.69
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.39
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.30
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.25
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.09
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.07
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.01
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.26
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.20
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.98
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.87
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.85
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.82
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.81
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.63
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.14
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.35
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.74
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.18
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.88
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.55
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.00
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.35
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.24
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.20
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.11
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.95
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.87
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.85
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.65
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.09
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.60
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.56
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.31
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.25
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.17
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.00
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.92
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.91
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.81
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.46
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.39
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.31
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.19
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.05
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.03
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.36
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.09
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.