Gene detail

Detailed information of KXJ23751.1 in Exaiptasia diaphana

Genomic Location: LJWW01000063.1:580775...587231
NR annotation: XP_020912174.1, mitogen-activated protein kinase kinase kinase 7 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ23751.1

ATGGCTGCAGACGATGACGATTTACAGCCCGATTCACCTCCTAATTTCGTTGAAGAAATAGAGGTTGGCGAGCTGCAAGTTATCGAAAATGTTGGTAGAGGTGCATTTGGAGTTGTTTATAAAGCACTATGGAGAGAAAAGTTCATTGTTGCAGTCAAGACCATTGAAGGAGAAGCYGAAAAGAAGGCGTTTCTTGTTGAGGTTGARCAGCTATCTAAAGTCAAACATGARTCTATCATCAAGCTTTATGGAGCAGTGATATCACAGGACCCTGTCTGTCTAGTGATGGAATATGCAGAAGGAGGTTCCCTCTATAACCTGCTTCATTGGACAAAACCAAGCCCTGCACCTATTTACRCGGTATCTCATGTCATGAGCTGGGCATTGCAGTGTGCTAAAGGTGTRGAGTACCTTCATGGGTTTAAACCAAAAGCCATAATTCACCGTGACCTAAAACCTCCCAATTTGTTATTGACAAARTGTGGTACRGCTATCAAGATATGTGACTTTGGTACAGCTTGYGATCAAAGGACKTACATGACAAAYAACAAAGGTAGTGCAGCTTGGATGGCTCCTGAGGTTTTTGAAGGTACAAACTACACAGAAAAGTGTGACGTATACAGTTTTGGGATCATATTATGGGAGATGATAACACGTCGTAGGCCGTTTGAAGAAATGGCAGGGGCGCCAGCATTCCGTATCATGTGGGCCGTCCATGGCGGTGAAAGGCCTCCATTGATTAAAGACATCCCAAAACCAATAGAAGACCTCATGACAAGCTGTTGGGATAAAGATCCAAAGCAAAGACCATCATTCAGCTCTATAGTGGTTTTCCTCAGTCATCTAATGCAGTTTTTCCCTGGTGCTGACACTTGCCTTGTATTYCCACCATCATCTCCAGAAACAGAAGAAAATGCRTTTACAGGGGGGAGCAATATTAGTGATACAGTCATTATGAACAAGCCACCTAAAGATGATACAAATGATGATGATGATGACGACGATGATGATGATGAAGATGGGCAAGAAGGCTACTTTGAACCAGAGGAGGTGGAAGGAGAATCAAGTACACCTAGAATTGAAAACAATGAGAAGTCTTCAGTATTGTTGCCTCAAATAAATGCCACACCTCAATCTCCRGAATGTTCAGTGGTTGGAAATAACACTGTACTGTTTGGCAAAATAGGCAGAGCTCGAAGTCCACTTCCWGGAATGCTTCCTGGAATTTCCTCTTTTAGTCCAGGAGAAGCCTCCCCAGGAAAGAATGGTACSAAAGACTCCTCACTATTRGCCAGTCCAAGACCAAGACAGACTCCTTCACCTTCCACTGACAAGAAGACTTCACCTGGAAATGCTGGTAGACCAGGAAGCCCACAAGACCARCAATTTACTAAAAGAACTACCAGCCAGAGCCCTCTTTCRATTGATGTCAATCAATGGCAAGGGGGTGCACCAACAAGCCAAGGATATATACAAGGGGGTAACCCTAACATGGGTATTATATATCCTCCTACTTCACAAGGGTACCCTAGTAATACTCCAACTTATTCAGGGTACCCCCCTGGAACTGGTCAAAGGTATTCACCAAGTGGCCAGGCATACCAACCAATAAACCACCCAGCAGTAAGTCAAGGTTACTTACCAACTAGTCAGGGGGGTTATATTCCAACAAGTCAGTACCAAAGACCAGCAAGTCAAGTATACCTTCCTTCCAGCCAAGCACACCCTATTTACAGTCAAGGGTACTTTGTCAGCAATGAGAACTATGGTCATAACGTAATGGGCTATCTTCCTGTAGACAGTCACATGGGCTACCAACATCCAGCATTGGGGGGTAGTATGCCTAATATATCTGAATCTGTACAAAGAGAAAACTACCCCCTGAACATCCCCCTGGATAATGAACGAATGCCAGTATACCCTCCGTCTCATCACAACACCACACTAAACAATTCTAATGAAGATATTAACGTGGAATCGATTGAGAGAGCATTACGAGAAGACCTGAAATTGCATGAATTATCAACAATACCAGGGAAATCAGCTCGRCACAAGTCAACAGGAAGTGCAAGTCCAGCTGATGGAAGYCCCTCGCCTGACCGCAAATTAAGTGAGCCGTCCCGTCCCAATGTGTGGTCTGGCCATCCTCCGGGGTATCCTAGGTCGGTGTCCAGTCCTTCTGGGACATTCCCACACGTTAGAGTTGGTACACCAGCATATGAGCTACTGGTTCCCGACCTACAGCCTATTCGACCAGATCCAACATTCCCAGAGTCAATGTCACTATATCAGCAGCACTGCCTTGTTGCTGAACAGTTCATCCAAATTCAAACAAAAATGGGAATTCTACTTCAACAAAAGAACAAGATCGAACGTCAGTTGGAAGAGTATGAACGAGAACAGCAACAAAGTGCTCCTTACGTTGAACAGTTTGCCATGTTATCCAGTGAAAAGGAAAGTCTACTGTTGCTGCACAAGAACTTGAAGAGGGATTTAGAGCATCTTCGACGAGCAAGAATAGCTTTTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2VDU3	Mitogen-activated protein kinase kinase kinase 7 OS=Bos taurus OX=9913 GN=MAP3K7 PE=2 SV=1
Q62073	Mitogen-activated protein kinase kinase kinase 7 OS=Mus musculus OX=10090 GN=Map3k7 PE=1 SV=1
O43318	Mitogen-activated protein kinase kinase kinase 7 OS=Homo sapiens OX=9606 GN=MAP3K7 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003270 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR017421 all species →	Family	Mitogen-activated protein (MAP) kinase kinase kinase 7-like	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46716 all species →	MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0004709 all species →	Molecular Function	MAP kinase kinase kinase activity	Interproscan
GO:0006955 all species →	Biological Process	immune response	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0007254 all species →	Biological Process	JNK cascade	Interproscan
GO:0043123 all species →	Biological Process	positive regulation of canonical NF-kappaB signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04427	MAP3K7, TAK1; mitogen-activated protein kinase kinase kinase 7	EC:2.7.11.25	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ23751.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

69TPM > 0

2Conditions

91.4Max TPM

56.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	35	54.05	86.14
whole animal · symbiotic	36	34	59.43	91.42

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	86.14
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	80.89
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	73.32
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	71.13
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	70.93
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	70.00
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	69.16
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	67.94
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	67.68
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	66.56
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	62.59
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	61.37
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	61.31
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	59.12
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	58.61
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	57.93
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	57.65
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	57.17
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	53.30
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	52.99
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	52.37
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	51.83
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	51.51
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	47.81
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	46.20
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	44.75
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	44.74
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.38
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	42.99
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.44
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.65
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.96
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.46
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.16
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.76
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	91.42
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	88.89
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	88.40
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	84.41
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	83.06
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	77.54
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	74.18
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	69.23
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	69.19
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	67.16
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	65.88
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	65.73
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	64.75
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	64.16
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	63.66
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	62.77
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	61.62
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	60.76
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	59.29
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	59.01
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	58.07
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	57.30
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	56.80
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	54.82
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	53.91
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	52.23
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	51.40
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.75
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.17
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	49.39
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	48.18
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	47.70
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	47.27
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.50
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.