Gene detail

Detailed information of KXJ24601.1 in Exaiptasia diaphana

Genomic Location: LJWW01000051.1:700552...704688
NR annotation: XP_020910014.2, amiloride-sensitive amine oxidase [copper-containing] [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ24601.1

ATGGCAGCAGTATCACCTTTATGGAAGTGGATCGCGTTGTTTTTCATTCTWCTCAGCCTTGGTTTACTCATTGCACTTATCGTTGTTGCAACTAAAGACGCCGGTAATGGAGAAGGTAAGAAAACCTCACAACTTCAAAAAYGTGGTGGAGATAGTTCGCAACCAAGCGTTACAAATAAGATATCAACAACGCCGGGTCTCTTCGATGATTTAACACCAGATGAGATGAACAAGGTCTACAATTACATGGTCAAAGCGTTCAAATTAAAATCCAGAGTTAMATTGCTCACAGACAGTATGATTACTCTTATCAAGTTCTACCCGCCGTCTAAAGATGCAGCCTTGGCTTATTTGGATGAAGGCAAAGAAAAGCCAGWGAGACAGGCTATTGTTGTGATATTCAAAGGAGCGGCTCAGCCTCCGATAGTCGAGGAATACCTTGTTGGCCCAGTATCTACACCGAATAAGCACGAGCTGTTGAAAGTAGATGGTCGGTCGTACCCTATCAACTTCGACGCGAGGCCGGCGCATTCTCCGCGTGAAGATACATTTCTCTATTATGTCATTATCAAACCAATGGCTACAAAACTCTATCGACTTATGTACGAGAGTTATGATGGATATACTATGGCTGATAATTGCACTGATAAGTGTTTGACTTACATTGTCTCGTCACCCCAAGGTCTAACTAGCAACACGAGAGAAAATTGGTACACTTTTGCTCGTCGCCAGCTAGCTTTTTATTCTCACCCAGTTAACTTAGAATTTTATGTGAATCATGCGGGGAACAACYATTTGCAGTGGCGCATAGAAAAGCTACTCTACAATCGACAGCTTTTTAACTCTACTGAAGAATTAATGGATGCCTATGACAAGGGAAGGCTCGTCAAGACATTTATTCCAGCTCCTAAAGGGAACGATAAACGTTTCTCCACTTACGAAAAACGAGGAAAGGAACAGCCTTCCAAACCCAGTCGAGGTCCTGAACAGTACGAGCCCGATGGAAAACGCTACTCTGTGAAAGGTAGACATATCGAGTACATGAACTGGGCTTTTGACTTCCGGGTTGATTCCATAAGTGGACCGCAAATATATGATGTAAGATTTGGAGGAGAGAGGATTGTGTACGAGATCAGTCTACAGGAGGCTATAGCGACTTATGGCGGATATTATCCCACACAGATGAGTAATAATATTCTTGATGGTGCTTATACCATGGGAGAAAAATCATTTTCTCTTGTAAGAGGCACGGATTGTCCAGGAACTGCAACGTTTTTTAATCTGGTGCACATGGTGTACACTGATACTCCATTCGTCATCAAAAATGCTGTCTGTGTATTTGAATGGAACACTGGATCACCATTAAGACGACATTACGATAACGACTTTCAAGGAGGATATACTTTCTATGGTGGAATGGTCAACCAGGCACTCGTTATGCGAACCATAGCTACAATTGCTAACTACGACTACATACACGACTTCATCTTCTACCAGAACGGCGCGGTAGAAGTGAAAGTGTCAGCATCTGGTTACGCCATGGGTACTTTCTACGATGAGAATGTAAAACCGTACGGTTATCCCATCCACCATAACTTAACAAGCACTACACACGATCACTTACTCAACTACAAAGTTGACTTAGATGTTGGYGGAAGACAAAATTCCTAYGAGACTATCGAAGTCACAACAGAGAACGTAACTGACAAATGGCTACCGGAGAAAAACAGATACTTTGTCAGGAAAGTCTTGAAACGTACCACCAAAAAKACMGAGCAAGAGGCAGCATACRAATTCAACTTTGACCGTCCAAAGTACTTGAACTTCTACAATGAAAAAAAGAAAAACAAAATGGGTGTGTCAAAAGGATACAGAATCCAGCTGAATGGTATCATGAAGCAGTTGTATCCAGAAGACTGGATAATGGTACCGATGATAAGTTGGTCTCTGTATCAGTTGGCTGTCACCAGGTACAAGGACACCGAGAGGGAAAGCTCCTCGTGGTACAACCAAAACTCACCAAGTGAACCTCATCTTGACTTTAGAAAATTTCTAGCAGACAACGAATCTATTGTCAATGAAGATCTTGTTGCTTGGGTAACCACTGGAATGATGCACATCCCTCATTCGGAGGATATTCCCAACACAGCCACGGTTGGAAGTACAGCAGGGTTTTATCTTCGTCCTTTTAACTACTTTGATGAGGATCCATCGATGGGTTCGAGTAACGCCATCTTGATAACACCCACTGACAAGAACTACAGTCCTTCATTCCAACGTTTTGGTACCCCGACTGGTCCTGTCTGTGTTCCTAAGGAATATCCTGTTACTTTCGATGGTCGGAACAGAAGCTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9TRC7	Diamine oxidase [copper-containing] OS=Sus scrofa OX=9823 GN=AOC1 PE=1 SV=3
P36633	Diamine oxidase [copper-containing] OS=Rattus norvegicus OX=10116 GN=Aoc1 PE=2 SV=1
Q8JZQ5	Diamine oxidase [copper-containing] OS=Mus musculus OX=10090 GN=Aoc1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000872 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01179 all species →	Cu_amine_oxid	Copper amine oxidase, enzyme domain	Domain	Interproscan
PF02728 all species →	Cu_amine_oxidN3	Copper amine oxidase, N3 domain	Domain	Interproscan
PF02727 all species →	Cu_amine_oxidN2	Copper amine oxidase, N2 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036460 all species →	Homologous_superfamily	Copper amine oxidase, catalytic domain superfamily	Interproscan
IPR049947 all species →	Conserved_site	Copper amine oxidase, copper-binding site	Interproscan
IPR015798 all species →	Domain	Copper amine oxidase, catalytic domain	Interproscan
IPR049948 all species →	Conserved_site	Copper amine oxidase, TPQ-binding site	Interproscan
IPR016182 all species →	Homologous_superfamily	Copper amine oxidase, N-terminal	Interproscan
IPR015802 all species →	Domain	Copper amine oxidase, N3-terminal	Interproscan
IPR015800 all species →	Domain	Copper amine oxidase, N2-terminal	Interproscan
IPR000269 all species →	Family	Copper amine oxidase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10638 all species →	COPPER AMINE OXIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005507 all species →	Molecular Function	copper ion binding	Interproscan
GO:0008131 all species →	Molecular Function	primary methylamine oxidase activity	Interproscan
GO:0009308 all species →	Biological Process	amine metabolic process	Interproscan
GO:0048038 all species →	Molecular Function	quinone binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11182	AOC1, ABP1; diamine oxidase	EC:1.4.3.22	Tryptophan metabolism	ko00380	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ24601.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

62TPM > 0

2Conditions

38.2Max TPM

3.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	30	2.64	5.85
whole animal · symbiotic	36	32	4.49	38.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.85
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.93
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.68
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.44
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.26
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.05
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.01
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.95
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.80
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.50
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.41
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.29
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.13
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.13
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.10
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.02
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.90
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.84
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.84
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.76
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.71
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.57
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.42
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.42
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.21
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.14
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.09
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.08
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.69
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.79
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.16
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.61
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.51
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.50
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.49
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.45
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.23
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.16
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.94
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.48
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.32
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.13
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.02
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.97
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.88
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.87
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.85
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.82
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.81
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.80
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.78
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.63
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.60
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.25
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.19
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.14
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.95
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.93
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.90
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.89
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.81
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	1.71
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.