Gene detail

Detailed information of KXJ26552.1 in Exaiptasia diaphana

Genomic Location: LJWW01000028.1:789725...796142
NR annotation: XP_020901463.1, MYCBP-associated protein [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ26552.1

ATGAGCAATAAACTATCAAGCAAGCCATCAAAGAGGGACAGACCTAAATCTACAGACAAGTCCAAAGGAAAGAAACAAAATGCAGGAACACCAGAAAAGGTTGGCAGTCCAGTACCTTCGACAATGGCTGTCATACAGCCAGACGAAAACAGTACTTGCTCAGGCAAAGTAATCTCTGGAGGTGACATCGAATCACTTGCGATAAACCAGGAAGAACTCAAAAAGGTGAGGGCTCCAAGAAAACCTGACATTCCTAAACCATCTACAAGGATAATGGTGAGAAAGACAAGGGTAAAAACACCACCAGATGATACAGATCACGGTGGAAAAAGGGTAACTGTTGCAAGACCAGCTCCACCTGATGCGCCATTAGTTGTTACACCATTGACTGGTTCTACGGGACCATCATTTGACAGTGAAGGACAAGTCTTGTCTCACACTATTCTGGGTTCCTGGGATGACTTTTACCAGGAAGCCATCAACAGGGGAGATATTGAGAACTTGCCTCCATTTTCTGGATCATTTGTGCATGCAAAAGAAATCAGGCCCCACACAAAACCAGAGAAGAAAACAAAAGTGACTTATCCAGTACATGTGTACCAAACTAAGGTTGATGAGAGTAAAGCATTGTTAAACTACCAAAAGCAAATGATGAATAGGAAACAGCAACAGAAGCATCTTTCAGATTCCCTTCAAGTTACAACTGACATGCTGATTATGAACCAGAGTGATGATTACAGGACGATACAAGAACAGAGACATGTGATTGATAGGGCAATTCCTTCTTTGGATTATGGTAAAGGATATCGTGTTGGTAGTGAGTTCTGGAAACAAGTACAACAAGTTGGTAATGATGAAACGGGAATCATGTCAACATTGACACAGACAGAACAAGGATACCCTCCTCCTATTGAACACATTGGAAAACCAATCTATGTCAAGAATGAAATGGGTATTGAATGGTCAAACACTAGGTGTAAGTCTGCTGTCCACTATCCTTGGCATGAATCAAGGTTTCTCCAAGAAAGAACTGAACAACTAGCACATGTTATGAATGAAATAGACCCTCATCAGCCATACATAGATAACCTAGAGGTGATTGGTACAAATAAACCTGTTATAGCATCAAAACACAGCATGTCAACTGTACCTGAAGAAGAAGAACCTGAGAGCCAGTTACAAGAACAAGGGGATCCATTGCGGAGCTATTCAGATGTCCTACCTCGTCCTATCCTTGGTCCTTCCTTGACTATTGATGGTCAGACAGCACAGTGGACTGGTGCTACCAACAACGGCCTGGGTCGTGTGGGTGTTTCTTGTAGAGTCTTATTTGAAGCTCATACGAATGAACGTTGTGTTTCACTTTTGAATATTTGCAATGATGGCACAACTGCAATATACTACTCTTGGAAGATGATTCCAAAGGCAAACAAACTGGGTACTCGTCTGGCTGGTTCAGTGCAACGTTTCTATTTCGATACCAACAGTGGAGTTATTTTACCTGGTGACACCATGAGGTTTCCTTTCATTTTTAAGTCTTGCAATCCAGGAATTTTCTCAGAGACATGGGAACTTTTGACACAGCCTGTGTTGTGTGGTGGTGCAGCATTAAGAATCTCACTTCGTGGTACTGCAGTAGAGGAAGATGTTTATGCCAATGTACGAAAAGAGATAGAAGAAGACCTCGCTCATAGGCAAGCTGTAGAAGCAGCATATCGTATTCTAGAGGAGATATTAGATGGAGTAAGAACACCTGAGCGTGCCAGGTCTCCTGTCGACGCCTATATAACGGAAGAAGAAATTTTCTCTCGAAAGAATGAAGGGCTGTACTTCCATGATGAGGTTATAAATGAACTCAAAGTTCTATACTCTGAATTGGAGCCTGATGAAGAATGGGATCTTTCTTTATCACAACTGCAACAGCGTATAATGGTTGTTGAGGAAGATGAGCAACGGGAGGAATTGTTGCAGAAACTAAACTTATCAATGGTGACAATGTCCTTCCCTCCCATGAATCCTGTGAAGCAAGCAATGTACAATGCAACATATCAGTTATTGAGTGAAATGGTTGACAATATGGTAAACCAGTCAGGTATGATTCGCAGTGTGTTAGGATTACCTGAACGAGACATGGTGGAAAATGTAGTGCAAGAAGAAGACAAAAAAGGCAAAAAAACGACAACTGAACCTGTCAAGCCTGACAGCAAGAAATCTGACAGAAAGGATAAGAAGGGTGGCAAAGCAGATCATGAAAGACCAGTTTCTACTCGTTCAAAGTTGTCTGCTAAAAAGGCTGGCAGAGGTACAACAACACCAACTTCACAACCAGCAAAATCAACAAGTGATGCTGAGAGACCTGTGACCCCAGCAAGCATAGAAGAACCAGGAATTGAACAAGTTGATCCAGTTCTTGAAGTCAAGTATAAAGAAAAACTCTTTGCTCAGGCATATTCACTGGTACTTGATACATTCTCTAAGTTGGATGTTATATTAGATGACATCCGAGCACATGATGTGACCAACAGCATGGAATTCCAAAGGTCATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5SUV2	MYCBP-associated protein OS=Mus musculus OX=10090 GN=Mycbpap PE=1 SV=1
Q69CM7	MYCBP-associated protein OS=Rattus norvegicus OX=10116 GN=Mycbpap PE=1 SV=1
Q8TBZ2	MYCBP-associated protein OS=Homo sapiens OX=9606 GN=MYCBPAP PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003529 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14646 all species →	MYCBPAP	MYCBP-associated protein family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR052822 all species →	Family	MYCBP-associated	Interproscan
IPR032707 all species →	Family	MYCBP-associated protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48333 all species →	MYCBP-ASSOCIATED PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was detected for KXJ26552.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25648	MYCBPAP, AMAP1; MYCBP-associated protein	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ26552.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

61TPM > 0

2Conditions

18.0Max TPM

8.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	30	5.65	11.03
whole animal · symbiotic	36	31	10.83	18.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.03
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.25
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.09
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.60
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.56
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.55
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.47
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.34
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.08
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.59
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.28
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.07
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.93
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.82
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.54
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.52
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.46
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.20
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.97
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.53
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.52
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.45
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.40
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.36
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.32
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.17
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.92
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.85
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.39
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.04
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.04
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.20
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.16
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.54
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.26
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.09
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.37
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.20
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.53
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.35
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.31
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.25
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.89
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.59
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.56
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.47
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.13
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.94
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.80
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.60
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.42
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.36
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.26
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.11
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.08
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.85
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.16
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.93
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.50
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.33
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.53
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.