Gene detail

Detailed information of KXJ26604.1 in Exaiptasia diaphana

Genomic Location: LJWW01000028.1:626532...634555
NR annotation: KXJ26604.1, Centrosomal protein of 112 kDa [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ26604.1

ATGAAGCCCTACGTTCTACGACTTCCCCACAAATTAGAGAGAAAAAGAGTTGGATTATGGATCAAAAAGCTTTGTGAGCCACCCGGACCAGTCCCCTCAGCAAGGAAGAACAGAAATTTATATGCTCAGCTGCTATTACATATGTTAAAAAGAGGTGTACTGGAAGACCCTTTCACAAGACGGCCAGATGCTGGTTCACTTCAGCCTTTACCTTCATATATGTCAATCTATTTAGATGAACCAATACAACAAAGAAGTCCAAGTCATGTTATCGATGAGGAATATGGAAGGGATCCCCCAGACTGGGTGAGAGACCTTGGAAGCTCAACAGCTGGTAGTATCATGGAGTTACCAACAACTAGTGGTGCTCATCCTGTGCCAGTAGGGAGGTCTACAACTTACAGTGGCTCCAACAGAGARCGAGACTATGGTAACCATGGATATCGTCCCAGGGAATCACTGGAGTATGTGAATGGAGACAATCACTATGGTAACGGAGTCAGTCATCAGGATGAATATTTTACACCACAAGAACCAGCATATAACAGAGAGTATCAGCACCAGGAAGTCAATTATCACACTAGTCCAACGGTACCCAAGCCTTATCCCATGAATGGTTATCAACAATATTCAAGAGGTGCTAATTTCACAGCTAACACTACTTTTAGAGATGATTTGAATTTTAGTAAATCCAATGAAAGAGAGGTTGAGCTGAAGATTAAAATGGCTGAAGCCAAATTTCATGAAGAAAAACTTAAACTACAACAACAACATGATGTTGCTGTCCAAAAGATTTTAGACCGAAAAAATACAGAACTTGAAGAGATCAAATCTCATTATCGTAACAAAATCACTGAACTTGAGAGTCTTGTCAAAAARCAAGAACGTAAAGTCTCCCAAGTGGCGAGAGAATCAAGTGCAATAAAAGAGCAAAAAGATAAACAGATTGCAGAACTGAAGACACTTGCCGAGCAGACTGGAGAGAGTGCATTAAACAACTACGAGAAAAAGCTAAGTGACAAGATAGCAGAATTTGAATCAGAAAAGATTGAAATGCAGAAACAGCACACCAATAATATCCAGGAACTTCTTGACGAAACCAATCAGAGACTGCAGAAGATGGAGGAAGAGTATAATAACCAGTCTGCCAGTACGGCTATAGTCATGCAAGATCTGGAAGCAAGGGTGCATCAGCTGACTGAAGAGTCTGAAGCTGTCCAGAACTCAAGATCAAAACTAGCCAAGGAAAAGGAAGAACTTGCTGATAAAGTTTTATCRCTGACAAATGAGCTGAAGGATGCTAAAACAACTTTGACCAAGTTTGAAAGAGAGAAGACAAAATTAATGAGTGAACACCAACAAGCAATTCAACAAATTCAACGGAAGACTGATTCCACTATAGAATTRCTGAAAAAAGAACATTCTTCTGTATCATCCAGGTCAGATGACGCCATTGCAGACTTAGAGAGTCAAGTCACTCAACTCAAGCAGGCCCTACAAGAATCTGAATTTCAAAGACAGAAACAAGTCAGGGAAATGGAATCTTCAGGTCAACAAGAGAAAATGAGTATAGAACATCTATATGATAAGAAGATCCAACGTCAAACCCAGATGCAGAAGCAACAATCTCACCAAGCGGAACGYGCTCTCAATGATTTCAAAGAACAAGTGGAAAAGAACTCGGGAAAAATGTTTGACGAGATGAAAACTCAGATGGAGAAGGTAGAAGAGGAYCTTGCTCACTCTAAAAAGCTGCGAGAAAAGCAAAGTAAAGAATTCAGTCGACAGCTCGATGACATGAAAATGAAACACGATAAAATGATTGCTGAGCTCAACATCAGCCATGAACAAGAAAAAGCACAATTGCTGAGAAGCTACCAGGCTGAACGTGACGGTTTGTTAAGAGAGCAAGAACAGGAACGGGATCTGCAAAGTGAAAAGCTTCATCAGAAAATGATGGACATGGAAACTCAGTTTAAAGAGAAGGCTACACGAGATGCAAAGGTAATAGCAGAATTAGAACAGCAAGTACGAGATTTACGCGAAGAGTTGATGCAGACCAACTCTCTTCGCAAAACACAGCTAATGGAGTTGAACATGCTCAGAGAAGAAGAAAAGCAAGCATACAAGAGACAAGAAGAAAATCTTCAAGCAAGATCAAAGAGTGATCTAGAYCAGCTAAAGCTAGAACTTCGAAGGACACATAGTAGTGAGATGGAGCAGCTCCTTGAAAAGACAAACGAGCGTCTTAGAATCATGGAGCAAGAATACACAAGCAGAGCTGATAAGACACAAGAGACCATTCGAACTTTAGAGGATGAAATGAAAAAACTGCGAGAGGAAAACTTGAGGGCACGACTGAGTTCTGAGAAGAAGCTTAGCGACATTACAAATAAATATAATGACGATAAGTCTTTGCTCAAGAAACAGCGAGACGGTATAGTCAATTCTTTGGAACAAGAATTGCAGGCCCAGAAAACTATGGTGCGTCACACTGAGAAACGATGTCAGCAGATTGACTTGGAATCACAGGAAAAGATTTCCCGTCTTCGTTTACAGTATGAGGAAAAAATGAAAGGACTGMTGCCTGAATCAGTAAGACAGGAACTGGAAGACACCATTGAATCACTTCGACAGCAAGTCTCAGTACTACAGTCACGTGCTCAAGTGTTACAAGAAGAACTGGACACAAGAAACAAACTATCAATGTCTTCACTTAATACATCTGCCTTCAGAGACGATTCCTATCGATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8N8E3	Centrosomal protein of 112 kDa OS=Homo sapiens OX=9606 GN=CEP112 PE=1 SV=2
Q5PR68	Centrosomal protein of 112 kDa OS=Mus musculus OX=10090 GN=Cep112 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003021 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14846 all species →	DUF4485	Domain of unknown function (DUF4485)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027831 all species →	Domain	Domain of unknown function DUF4485	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18871 all species →	CENTROSOMAL PROTEIN OF 112 KDA	Interproscan

Gene Ontology

No Gene Ontology signature was detected for KXJ26604.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16767	CEP112; centrosomal protein CEP112	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ26604.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

64TPM > 0

2Conditions

50.3Max TPM

14.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	32	10.64	29.75
whole animal · symbiotic	36	32	18.62	50.31

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.75
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.44
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.99
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.70
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.53
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.28
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.24
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.18
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.89
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.85
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.40
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.26
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.92
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.36
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.22
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.01
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.87
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.44
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.91
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.61
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.57
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.44
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.38
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.31
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.02
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.99
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.96
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.47
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.36
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.29
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.15
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.10
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.31
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.39
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.75
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.34
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.73
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.56
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.91
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.01
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.76
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.43
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.26
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.74
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.30
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.04
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.03
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.05
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.03
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.35
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.16
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.88
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.85
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.84
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.51
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.31
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.14
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.47
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.30
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.00
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.51
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.19
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.16
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.09
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.