Gene detail

Detailed information of KXJ27120.1 in Exaiptasia diaphana

Genomic Location: LJWW01000023.1:179526...190729
NR annotation: XP_020898913.1, 85/88 kDa calcium-independent phospholipase A2 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27120.1

ATGGGGGCAAGTACATCGAATTTTCGTGTAGAGGAAACGACATTACAACAGTTTTCGTATGCGACTTTGCTGGAGAAGAAAGACTGTGACAGAGAAAGCTTTCAGTTGTTTCGCGTTACWTCTTTTCGTTATGAAGCTATACTATTCAAAAATGATGACCATCCTAAGTGCCTCAGTCTTTTCAGAATGGACGATGAACAAGCAGCGAGGGATAAGTTTAAAAGCCTCTACAAGAAACTCTCTCCGTTCTATAAGACATCTGTGAAATGTTTTAATGCTGGGACATTGCAAGAACTGATTGATACCATGTACCAACATCCAGAATGGACTYTAGCTGATGTTGCCAAGCATCTTGACCTTAGAGAATGCTTAAGTCATGAGCATATTGCTGCCTCTTCAGAAAACAAATCAGCCAGTCCCCTCCAAGTAGCTTGTAAGACTGGAAAATTAGACTTCATTCAAAGTTTGACAAGTATCAATGCCCGCGATTTTGTTAAGGACAAACTTGGAAATACACCACTGCATTATGCTGCTGAAAACTACCCTGAAATACTCATATCAATGATTCARAAGGCACAATATTTAGGAACACAAGTCTCAGACGTTGTCAACTCGCGTAATGCCGATGACCAAACAGCTTTGGATGTGGCCTGTCACTTCTCACAGGATCAGGGAGTYAAGGTTTTGTTAGAGGCTGGTGCAGATGTGAACCATGTAGAAGGCTAYCAAAAACCAATTCACACAGCTCTTAAATCCAATGGTACACGGTGTGCAGCGCTGATCTTAGAGTTTCACCCTGACCAGATCAATGAGAAGGATTTAAAGTATGGTGCTTTTCCATTACATTGGGTAAAAACCAAAGAGGGAGTTCGTCTTCTCTTGGAAAAAGGAGCAAGTATTGAGTGTAGAAATAACGACGGGGAGACACCTTTGCATGTTATGGCCAGACGGAGAAGACTTGGRTGTGTCATTGTATTGCTGTCCTCTGGTGCTGATGTCAATGCAYGCAGYAGTGATGGATCTACACCGCTGCATATTGCATCACAGGCAGACGACTGTGACATTGTACGAGCTCTGATTGTGTTTGGTGCAGATGTAAATGCAACCAACAATAAATTCCAAACAGCGCGCCATATTGCTACACAAGAGCACCATCCAAGATGGAAAGACGTAGTTGATGCGTTATGCTACGTGGGAGCATCGCCTTGTGACAAAGCGAAAACMAAATGTAACCTTCCATGCAGTAAAGAATTCAAAGGAGAATTGAGAATAGGTGATAGTGTCAACAAAGTYRCATCGGGTTTTTTTAAATCGTCTGGTTTCGAAGACTTGATCAGGGCCGCCGCTGTTAGTGCTGCRTTATTCAGTTCCCCAGGTAAAGACTCTGTAGATGGCGGCTCAAAACCGAAAAGAGCGAAGTCTATCTTTAAAGAGAAAACTGGACGGGATTCAGTTCTGGCTATGGACGGGGGAGGAATCAGAGGTCTGGTACTAATACAAATACTGCTGGCCATAGAAGAGATAACCGGCAAACCAATCACCGAGTTATTTGACTGGATAGGTGGGACAAGCACTGGTGGTATATTGGCATTGGCTTTAATCCACGGAAAGTCGATCAGATACTGCCAGGGTTTATACTTTAAATTGAAAGACGAGGTTTTCAATGGACAAAGACCGTACAATTCAGAGCCTTTGGAAAGATTGTTGAGAGAAGAGTTTGGCGAGAATACAATGATGACATCGGTGAAACATCCTAAAGCTCTTATTACCGCTGTACTAGCAGACCGTCGTCCAGCAAGCTTATACTTCTTTAGAAACTATGACATGCCAGAAGATAAGGCATCAACTGCAACAAAGTCACCATTTCCATCGCCTCCTCCTCCATCAGAACAACAAGTATGGAGAGCTGCACGAGGGACAGGAGCAGCACCTACGTTTTTCCGTGCCATGGGACGTTTTCTAGACGGTGGTTTAATAGCCAATAATCCAACTCTAGATATTCTCACTGAAATACATAAGTACTACCAGGTACACTGCCCCGAAGCAAAGAAAGGCGTTGGCTCATCAAACGTAGGTCTAGTTGTGTCCCTAGGTACTGGTGTGCCACCTACAGAACATGTCATGAATATTGATGTCTTTAAGCCGGATTCGATATGGGATGCCTCCAACATTATAACTGGCGCACGCGCACTTGGTATGCTGYTGGTMGATCAGGCCTGCGCGACCCATGGKCCGGTTGTAGARCGTGCAAGGGTCTGGTGCGAGATGATTGGAGTCTCGTTCTATCGTTTTAGTTCTGATATGTCTTTTGAAGTTGGACTTGACGAAACAGACGACAGACTCCTCGTAAAGATGCTTTGGGAAGCTAAAGTCTATGTTTTACAAAAYATTCAATCTTTTAATGAACTTTCCGAAAAATTAACTATGTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O60733	85/88 kDa calcium-independent phospholipase A2 OS=Homo sapiens OX=9606 GN=PLA2G6 PE=1 SV=2
P97819	85/88 kDa calcium-independent phospholipase A2 OS=Mus musculus OX=10090 GN=Pla2g6 PE=1 SV=3
P97570	85/88 kDa calcium-independent phospholipase A2 OS=Rattus norvegicus OX=10116 GN=Pla2g6 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003963 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF01734 all species →	Patatin	Patatin-like phospholipase	Family	Interproscan
PF13857 all species →	Ank_5	Ankyrin repeats (many copies)	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR002641 all species →	Domain	Patatin-like phospholipase domain	Interproscan
IPR047148 all species →	Family	85/88 kDa calcium-independent phospholipase A2	Interproscan
IPR016035 all species →	Homologous_superfamily	Acyl transferase/acyl hydrolase/lysophospholipase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24139 all species →	CALCIUM-INDEPENDENT PHOSPHOLIPASE A2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006629 all species →	Biological Process	lipid metabolic process	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0016290 all species →	Molecular Function	obsolete palmitoyl-CoA hydrolase activity	Interproscan
GO:0047499 all species →	Molecular Function	calcium-independent phospholipase A2 activity	Interproscan
GO:2000304 all species →	Biological Process	positive regulation of ceramide biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16343	PLA2G6, IPLA2; calcium-independent phospholipase A2	EC:3.1.1.4	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27120.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

67TPM > 0

2Conditions

23.6Max TPM

8.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	7.63	23.57
whole animal · symbiotic	36	33	9.80	14.02

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.57
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.65
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.21
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.58
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.48
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.14
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.61
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.60
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.57
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.56
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.47
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.35
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.31
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.23
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.20
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.94
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.69
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.52
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.51
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.27
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.15
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.93
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.80
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.76
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.64
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.53
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.40
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.29
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.27
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.95
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.85
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.71
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.59
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.41
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.02
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.26
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.25
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.83
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.69
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.45
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.42
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.00
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.99
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.99
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.95
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.83
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.56
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.28
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.78
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.73
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.46
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.44
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.35
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.33
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.24
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.17
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.13
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.62
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.53
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.47
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.42
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.88
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.71
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.58
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.35
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.17
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.03
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.