Gene detail

Detailed information of KXJ27143.1 in Exaiptasia diaphana

Genomic Location: LJWW01000023.1:500886...508094
NR annotation: KXJ27143.1, Kinesin-like protein KIF23 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27143.1

ATGACTGGAACGCCCAGTGATAGTGGTTTATTACCACGATGTCTGGATGTCATATTCAATAGTATAGGAGAACTACAAACAGAATCGTGTGTTTTCAAACCTGATAAGAACAATGGATGGGAGGTGCAATCTGAGCAAGATGCAAAACTTGACAGAGAAATCAAAGAAAAAGAAGCATTATTGAAGGCATCAGCACCTACACCAAAAAGAAATGGTAACATGGATACAGATTWCTCAGACATGGTTCGCATACCAGAGACTGGAAAAATTGATAATGTTGATGAAGACAATGGATACTCRGTGTTTGTTTCCTACATTGAGATATACAACAACTACGTCTATGATCTTTTGGAAGAAGTTGAGATTGATCTCATTTGTCCAAAGCCACCTGTCTCCAAGAATCTGAGAGAAGATTTTGATAAAAACATGTTTGTCAGTGGAGTTACTGAAGTCGAAGTAAAGAGTACTGAGGAAGCTTATTCAGTGTTTTGGAAAGGCCAGAAAAGAAGACGTGTTGGRCAGACAATATTGAATCAAGAGTCAAGCCGTAGCCACAGTGTGTTCGCAATAAAACTCGTTCAGGCTCCATTGGATCCTGATGGTGAAGAGGTTTTACAGGATAGTGGCCAAGTAGCAGTGTCAACATTGTCYCTTTGTGATCTGGCTGGTTCAGAAAGAACCAAAAGAACTAACACTGGTGGTGACAGACTAAAAGAAGCTGGAAACATTAATAATTCTTTGATGACTCTAAGGACATGTATTGAAATACTACGYGAAAACCAGTCAAATTATGAAAATGGACAGCCAACCAGAATTGTCCCTTACAGAGACAGCAAGCTAACACATCTTTTTAAGAACTTTTTTGATGGTGAAGGAAAAGTRAGAATGGTTGTCTGCCTTAATCCAAGTGCTGAAGAGTATGATGAGAGCATACATGTAATGAAGTTTGCTGAGCTCACTCAAGAAGTGGTTGTTGCWAGGCAATCAGCTATCAAGTTTGAAACTGGACTTACTCCAGGAAGAAGAAGAGCCAATCAGATGTTCAGGGAGGCATTGGCGCAAGTTGATACCAATTCAGGACAAAACAAGGATGATACAGTAATTATTGCAAAGCCAATTCACACCATGGGACCACCTTTCCCTCTTACTTTGTTGACGTCTGCAGATGACAGTCATACCCTTTTCAATTTGATYGAATATTTACAAGGAAGAGAAAGAAGACGCCGGACGCTACTTGATGATTTGGATAGAAAACAGGGAATTTTCAGGGCACAGCTTTTAGACATTGAGAAGGAAAACAGTGGAGCCAACAATGCTATCAGTAATTTGAAGGCCACTATGGAGGAAAAGGATAAGGAAATCCAGAGACTTGAAAGAAGATTGAAAGCAGCCCTTCATAAGAATGAAATGCTTCAGAAAACAGCTACAATGTATGAAAATGAAAAGAGAGAGCTACAATATGAGCTTGTAGACTTGAAGAAGAGAGCAGACAAGGAAAAGCAAGATAAACTAAAATTGAAAACTGCTCTAAAGGGTGTGGTCAGTCAAGAAAAAGATAAATGGGAAAGAGAATGTAATATGAAAAGTGACAGACCAATGACAAGATCACAAACAAGATCAGGGAGCAACTCAGAAAGGTCTAAATCACCACCACCGGTTGCTAAGAAGGCAACAAACTATGCTCTGTTAGACCAGGAAGAAGAYTCAGATGGTGAATTAGCAACTAATGTAATCAAGGGTGATGTGTATGAGACCATAGCTGGTGGCTCRAGTGTACAGTTTACTGGAGTTGAGACACTAAGAACAAAGCAACAATTGCAGTCCAGTCCAGACAGAAAACGAAGAGCATCTGATGAAGATGAACAATGTTGGACTGATGTTGAAACAAGGTGTGCTTATGCCATTGAATGCAAACCAGATTCAGGCCCTGCATATTTGCACAATTATACGTTTTGTAAAATTTCAGGCGCAAAAAGACCTGACTTGAAGCATAAAAGACATGAATTGAGCATAAATCAAGCAGTCAAAAGAGCAGCACTAAATGCCACAACACACTCAGTGGCATCCACAGCTAATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E9Q5G3	Kinesin-like protein KIF23 OS=Mus musculus OX=10090 GN=Kif23 PE=1 SV=1
Q02241	Kinesin-like protein KIF23 OS=Homo sapiens OX=9606 GN=KIF23 PE=1 SV=3
Q96Q89	Kinesin-like protein KIF20B OS=Homo sapiens OX=9606 GN=KIF20B PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003207 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00225 all species →	Kinesin	Kinesin motor domain	Domain	Interproscan
PF16540 all species →	MKLP1_Arf_bdg	Arf6-interacting domain of mitotic kinesin-like protein 1	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019821 all species →	Conserved_site	Kinesin motor domain, conserved site	Interproscan
IPR001752 all species →	Domain	Kinesin motor domain	Interproscan
IPR038105 all species →	Homologous_superfamily	Kinesin-like protein Kif23, Arf6-interacting domain superfamily	Interproscan
IPR032384 all species →	Domain	Kinesin-like protein Kif23, Arf6-interacting domain	Interproscan
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR027640 all species →	Family	Kinesin-like protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24115 all species →	KINESIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003777 all species →	Molecular Function	microtubule motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005871 all species →	Cellular Component	kinesin complex	Interproscan
GO:0005874 all species →	Cellular Component	microtubule	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ27143.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27143.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

64TPM > 0

2Conditions

26.3Max TPM

12.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	31	9.21	26.29
whole animal · symbiotic	36	33	15.37	25.36

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.29
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.17
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.59
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.41
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.22
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.19
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.99
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.81
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.71
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.71
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.21
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.85
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.38
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.75
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.42
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.39
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.48
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.32
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.31
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.28
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.26
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.55
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.50
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.26
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.62
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.19
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.92
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.87
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.72
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.71
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.44
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.36
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.31
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.76
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.06
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.66
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.89
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.38
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.35
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.06
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.00
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.74
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.41
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.40
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.94
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.61
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.44
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.43
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.42
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.98
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.40
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.29
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.28
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.07
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.68
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.59
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.23
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.63
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.30
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.26
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.78
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.50
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.88
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.34
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.