Gene detail

Detailed information of KXJ27150.1 in Exaiptasia diaphana

Genomic Location: LJWW01000023.1:713966...720377
NR annotation: XP_020898980.1, uncharacterized protein LOC110237708 isoform X1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27150.1

ATGGCATTTGGTCGTTCGTGGTTCTGGGCCTTTCGTTTATTAAGGAAAAGAGACAAATGTCTTATTCTTTTGACTATTGCATTGACTTTTCTTGGATTTCGTCGATTTTGGCAGCATTTTCAACTTCGACAGAAGGAAACTGCCTACAATGACGTCACCGAACTTATTGCAAAGTCTACTAATTCTGCCCATTTAATCCAACTATCTAAAGACATCAAGATTTTTTACAAAGTCAAAATAAATAACGGCTGGCATAATAACATCAATGTAATAACCATTTTCAATAGTGGAACAACTTCTATCTTTCTTGGAAACTCTGTACTTTATTTTTGCAATATGAAAACTATTCACGAAACTTCCAACGAACTTTTAAAAGTCTCTCACATCGATGGATGTTTATACAAAATAGAACCGGTTTCTAAAAGCCTTAAGATTCATCCCAATCAAGAAATCAGTCTGGAACATAAAACCAAAGTCTACGCTGCAAGTCGTACGGATGTTATGCCCAATTGGTTTTTTGTTGGTCCAAATAATGAAATCAGTGTAGTGGAAAACACTGCTGGGGAGGGGCTAAAATTTATATCAAACTTCACGACGAAGGATCAGTGGAAGCGAGAACCTGGTGACGAGAACGATCCGTATACGCCAGAGGAGCGTTATCATATAATAGGGTTTGATATCCCAGAGGAGACGCCATTGCCTGTCGTTATTCCTCAGCCATTAAATGTCATGAACCTCGACAGGACAAAAACAATGATTATAGACAAATCTTGGAGTATATACGGCGAGCAAGGACTAGAAAATGAAGCGTCTTTTATAAAAGCATTTTTTCACATTCTGGATTCAGCAGCATCGTCTAAAGATCACAAAACAAAACATATCGTTCTGATAACTGGCGACCCGCAAGTGGACACTGGAAAATCTCTGGATGAGTCTTATGTACTCACAATCAATACCGCAGACCAATTCATTGAAATTATTGGAAAATCTAAAACTGGCGTGTTTTATGGTATCCAGACGTTGATTTCTTTGGCAGATGAAAAAGGTGCAGTACCTATGGTAACAATTAAAGATGCCCCCAGATTTAATTATCGTGGAATGCAAGTTGATGTTAGTCGTAATTTTATGCATAAAGAGGGCATTCTGCGTCTTCTTGATGCCATGTCTATGTATAAATTGAACAAATTCCACTTTCATTTGAGTGACGATGAAGGATGGAGGCTTGAGATACCTGGACTTCCTGAGCTCACAGAGATTGGCTCAAGGATGTGTTATGACACAGAAGAACTCAAATGTCTCTCTGTGCAAATGGGTGCCAATCCAATCACTTCCACAAAACCCCACTTCTACACCATCAAAGATTACCAAGAAATTCTCCAGTATGCTAATAAACGCCACATTCAGGTTATCCCCGAGTTTGATATGCCTGCACATTGTAATGCAGCTATAAAGTCCATGGAAGCAAGATACCGGACGTACAAGAACAGAGGAAATCTTGCTGCAGCTGAAGAATTTCTCTTGACTGAATTCGACGACACCTCTAAATACTCTTCCATTCAAGGRTACAAACACAACACCATAAATCCTTGCTTAGAATCCACATACAAGTTCATCACMCACGTTATCAAAGCTCTTAAYGACATACATGAGAAACATCAGAAGCTCACCGTATACCAATTTGGKGGCGACGAAATTCCTAATGGTGCTTGGGGAGATTCACAYGCCTGTTCAAAGCTCATCAGTAAAGGCGAATACAATACTTTGAAAGATCAATTGAAAGAGCATTTTGTTAAACGTGTAGGAGCTATAGCAGACTCTTTTGGTCTGACATTCGGTGGTTGGGATGACTTCTTCTCTGTTAAGGAGAAAATCTTTCCAAAGAAAGATGTCATGGTATGGTCGTGGAACGATTTGCCGCAACTTAATGGAGGGGAGAAGGCATACCAACTTGCAAACGCAGGATATAAGGTTGTGCTAGCCCATGCATCTCATCTCTATTTCGACCATCCACAAGAACCTGACCCGGAAGAACGTGGCTTTTTCTGGGCGACACGTTTCACTGACACACGCAAAGTCTTTGAATACATTCCTAATTTCTGCAAGACCGCTGGTCAATGCAACGACGCAAGCGCTGAAAATAACATCTATGGAATTACGGGTTGTCTGTGGGGTGAAACGGTGAGAACCGTCGACCAAATGGAGTATATGGTTTTTCCCAGACTTCTAGCGCTGGCAGAGCGAGCTTGGCACAAAGCACCATGGGAAGATATTCAAAACGATGCGGAATTGAAGGAAAAAGTGGTTGAAGAATGGAAACAATTTTCTAGTTTTATCGTAAAGCATGAGCTACGAAGACTGGAAAAKCTTGGCATCAAATATCGTATACCTCCGCCTGGCATAAGGTTTGAAGGGAAATCTATCAAAGTACGAACCGCTTTACCAGGACTTCCAGTTCAGTTCTCCAAAGATGGAGGAAAATCGTGGCACGACGTCACTGAAGACACGCAGATTGAAGAAAACGTCATGGTGAGGACGAGTTCAATAGATCGTCGGCGCATGAGCAGAACGATTGAAGTTCAAGGTCCAAAGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04786	Beta-hexosaminidase OS=Vibrio vulnificus OX=672 GN=hex PE=3 SV=1
Q54468	Chitobiase OS=Serratia marcescens OX=615 GN=chb PE=1 SV=1
P13670	N,N'-diacetylchitobiase OS=Vibrio harveyi OX=669 GN=chb PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000952 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02838 all species →	Glyco_hydro_20b	Glycosyl hydrolase family 20, domain 2	Domain	Interproscan
PF03173 all species →	CHB_HEX	Putative carbohydrate binding domain	Domain	Interproscan
PF03174 all species →	CHB_HEX_C	Chitobiase/beta-hexosaminidase C-terminal domain	Domain	Interproscan
PF00728 all species →	Glyco_hydro_20	Glycosyl hydrolase family 20, catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015882 all species →	Domain	Beta-hexosaminidase, bacterial type, N-terminal	Interproscan
IPR004866 all species →	Domain	Chitobiase/beta-hexosaminidases, N-terminal domain	Interproscan
IPR008965 all species →	Homologous_superfamily	CBM2/CBM3, carbohydrate-binding domain superfamily	Interproscan
IPR029018 all species →	Homologous_superfamily	Beta-hexosaminidase-like, domain 2	Interproscan
IPR025705 all species →	Family	Beta-hexosaminidase	Interproscan
IPR014756 all species →	Homologous_superfamily	Immunoglobulin E-set	Interproscan
IPR004867 all species →	Domain	Chitobiase C-terminal domain	Interproscan
IPR012291 all species →	Homologous_superfamily	CBM2, carbohydrate-binding domain superfamily	Interproscan
IPR015883 all species →	Domain	Glycoside hydrolase family 20, catalytic domain	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22600 all species →	BETA-HEXOSAMINIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan
GO:0004563 all species →	Molecular Function	beta-N-acetylhexosaminidase activity	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0030203 all species →	Biological Process	glycosaminoglycan metabolic process	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0030247 all species →	Molecular Function	polysaccharide binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12373	HEXA_B; hexosaminidase	EC:3.2.1.52	Chaperones and folding catalysts	ko03110	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27150.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

65TPM > 0

2Conditions

36.7Max TPM

7.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	7.06	14.88
whole animal · symbiotic	36	32	6.95	36.70

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.88
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.82
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.91
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.11
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.99
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.96
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.84
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.84
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.63
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.47
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.46
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.45
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.17
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.98
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.93
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.61
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.56
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.31
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.25
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.11
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.06
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.70
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.42
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.41
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.39
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.22
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.20
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.03
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.93
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.89
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.85
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.74
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.20
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.70
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.58
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.56
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.22
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.45
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.81
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.43
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.29
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.11
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.59
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.41
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.39
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.18
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.94
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.81
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.64
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.58
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.52
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.27
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.13
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.54
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.36
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.36
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.35
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.32
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.15
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.96
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.72
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.50
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.48
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.20
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.75
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.