Gene detail

Detailed information of KXJ27161.1 in Exaiptasia diaphana

Genomic Location: LJWW01000023.1:190866...194321
NR annotation: KXJ27161.1, Zinc finger protein 345 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27161.1

ATGTCGGATTATAAAGCTCAAGGMTGGTTGGAGTACAGATGTAAAGGTGGAGATCTTCTGTTTTACTACAATAAAATAACAACAGAGCACAGATTTCCAAAGTGGGACTTTGATACAAAGAAATGGAGTTTGGGAGAGGCTATCGAGGGCGCTTCTGTGAACAAACAWGTCAMCATATCAACGCAAACTGATGATACAGGGTGTAGCAATGGATGCACATCAGTGTATGTAGACATCGACAAAGCTGAACAACAAGAACAAAACCGAACACGTGATATATGGACACAAATTAGGAAAGAACTTGTCAGCATTGATGATGTAAAGAGAGAAGTAGAAAAGACCGGCAGTACAACAGCTAATAATGCGCAACTGACTGGAGAAGGAAAAAACGACACAAAAGACACGGACACCACCCCAACAAGGTACGATTCAAGAAGAACGAGTCATCCTCAGTTGCTTAGAGAAGAAAATCAAGAAAATGGAATAAACCCATACAAGAAATCAGATAATCACCATCTCAGACCACAAGGAAGAACKACTAGTCCACTGGTTTTTCCTTTAACTGGAACAGGAAGTGACAGTGAGAGTGAAACCAGCAATGTAGACAGCACTGTTGAGGATGATCCAGACAGCTTCTTGGGTTATGGAGACCAACTACGCCCAACTAAAGCGACCGAGTGTGCAAGGTTACAATTAGCTGTTAATRAACTGAACGAAAATASTAATAATTGTAGCACGGAAAATAGTTTAAAAGCTAGTAAACTCTCTGACAGCACTAACAAAGAAACATCTCTAGTCACAAGGAACAAAGGAAAGCCACACATGTGTGATYATTGTGGTCGCGCATTCACCCATATTACTGCCTGTAAATTACATGAAAAGATCCATTCAGGAGAAGAAAAYCAATATTACAAGTGTGAATATTGCAGTCAGACATTTAGACTTCGACGAGCTCTTAGAGTACATCAGCGCACAGTCCACATTGAAAGAATGTTTAAATGTACGTCCTGTGACAAAATGTATAAAACTAARCAAGGCCTTGTATTGCACGAGGCCGTTCATGATCCAAACAACAAGCCACACCAGTGTCAGTATTGCAASGCGGCATTTCGATGCTTAACGGAATGTATAAGACATATGCGCATTCACAGCGGGGACCAAACAGGTGAAAAGCCATTTCAATGTCAATATTGCAGCAAGACATATAAAAACAGAAGTACGCTTGCAAYACACTTGCGCAATCACACTGGAGAAAAGCCATACAAGTGTGAATATTGCGCAAAGACTTTCAGATTTTRCGSAKCACGTACACWGCACATGCGCGTACACACAGGAGAGAAGCCATACAAGTGTCAATATTGCAGCAAGACATTCAGAAGAAATTCACATTGCAAGTCGCACGAGCGTATTCATTCTGGTGAGAAACTATTCAAATGCAAGGATTGTGGCATGGCATTCACGCATGATTACAAGTTAGAAAGACATCAGTATTCACACTCTGCTGAAAAGCCATTCAAATGTCAGCAATGTGCAAAGACATTTATAACCAGCAGCGAACTTAAGAGACATCATCGTGTTCATTCGGGAGAGAAGCCATTTAAATGCAAGCATTGCGACAAAGCATTTTCGAGTAACAGCCACTGCATTAGGCATGAGCGCATTCACTCAGGAGAAAAACCTTTTAAGTGCRAACACTGCGATAAAGCATTCAAATCATCGAGTGACCTCAAAAGACATGAGATTTCCATGCATTTAGAAGTAAAAGCATTTAAATGCAAATATTGCGACAAGGCATTTGCACTTAGTAGCAATCGTAGGCAACACGAACTCCTTCATTCAGGAGTGAAGCCTTACAAATGCAGTCATTGTCGCAAATCATTTGCAACACGAAATCATCGCAAATTGCATGAGCGTGTGCATACAGGGGARAAGCCATACAAATGCAAATTTAACAATTGTGACAAAAAATTTAGCAATTCTTCTTGCTTAAAGAGACACGAGAACTGCCATACTAAACCATTTAAATGCAAGCTCTGTGGAWTGGCCTTTGATCGGTCCAGTCGGTTGAAAAAACATGAAGAGACACATGTTGATGAAACTCCCTAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001092 (this species only)
Transcription factor family	zf-C2H2 · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00096 all species →	zf-C2H2	Zinc finger, C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24381 all species →	ZINC FINGER PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was detected for KXJ27161.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09228	KRAB; KRAB domain-containing zinc finger protein	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27161.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

61TPM > 0

2Conditions

9.5Max TPM

3.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	31	2.77	9.53
whole animal · symbiotic	36	30	3.63	7.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.53
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.15
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.84
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.42
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.99
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.95
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.70
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.69
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.58
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.57
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.52
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.46
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.39
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.10
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.09
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.89
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.80
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.74
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.69
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.68
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.67
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.61
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.41
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.37
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.36
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	2.33
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.95
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.82
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.76
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.60
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	1.03
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.93
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.26
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.65
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.58
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.49
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.45
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.36
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.35
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.04
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.80
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.77
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.53
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.15
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.12
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	4.10
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.89
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.88
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.71
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.69
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.69
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.47
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.45
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.39
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.31
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.13
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	3.00
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.93
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.70
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.45
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	2.40
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.