Gene detail

Detailed information of KXJ27182.1 in Exaiptasia diaphana

Genomic Location: LJWW01000022.1:440947...458309
NR annotation: KXJ27182.1, Growth arrest-specific protein 2 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27182.1

ATGATGGAACAAAATGTTGAATTCTCGGACTCAGTGGTCAATATAGCATGTACGCCAAGAAACAGAGCSAACTTACGRCGGTTAAAAACAACCAGTATACAGAGCTTTCAACGATGGGAGAAAGAAAATGARCTGTTGTACGCCATGATCGAGGACGAGAGCACTTGGCTCTCCACTCTTTTTCCTGATATATTTATAAATGCTGATCTGTTCTTTTACGCTTTAGAAGATGGGACACTTCTTTGTCTTTTGGCCAACTATATTCAAGACATGGCCGAGAAGTACAGTCAAAGAACTGGTAAGCCAGTACCTGGAAAAAAAGTTACCTTTCATAAATCTAGGAGGGGGATCAGGGAATCAAAGCTGTTTCATTCGCGGGATAACGTTGAAAAGTTTTTGTCTTGGTGTCGCCAACATGGCATTCCTGAAGCCATCTTATTCGAGTCGAATGATGTTGTTCTTGTAGATGAATGTAGGACAGGGGGACGAGAAATTGTGATTTGTTTAATGGAGATTGCAAGAAGATGCAGTTCCTATGAATTGCAACAATTACCTAAATTGATTCAGCTAGAACGAGAAATAGAGGAGGAAGAATTTTGTCAGGCCGCTACAACTGCTTGCGAACCTTTGACGCTGGACACTGGTGGTAGTAATGACATTCAAGGGGRCAGAAGCCCGATTGATTCGGATTCTGGCGTAGAGTCAGTGTTTGATGAAGGAGTTGATCCAACTGTCCCGCAACTAATGGAATTCACATTAGATGACAGTCATGAACACATCGAAAACTATGTTGCGGGCACCACAAASACTCTCGAAGATCAAAAGCCTACAAAACAACAAAAAGAACTTTCATCTTTACTGGAGAGCAAGGGTCCCAAGACTGAACTTGATAAAAAGGTATGTAAAATTGCACAAGATTATAACATAAAGATTGTCCATAGACTGAAAGAAGGAAAATACATTATTCTTGGAAAAACTATGTTTGTTAGGATGTTAAATGACCATTTACTTGTACGTATTGGTGGWGGATGGGATACATTGGAACATTATATCATGACCCACACTCCAAAGCCAACCACAGGTGAAAATCCCATCTCTCCACCTTCACAACAACCAGATAATCATCGCAAGAAATCTGGTGTTTGGAGCAAGCTTGTTGAAAAAGTTAAAAGAAGGGAAAGTCAGCCAAATATAACAGCTTCTCCTGTTGTTATTTCCAAGAAACCAAGACCTGATAGCTCACCTGTGTCCTACAAACTTCGCGATCGTTTTACGAAAAGATTATCTGTAGAGGAGAAAGACGGGAAAGATATCTCGGAGGCAATACAAAGAATTGAATCATCAATATTGCTCACACCAAAAGATTCACCATCTTTTACGTCTAAGACATTTTTCCAACTGAAGAATCGGTTTGATCGAGGAAGAAATTCAAGTGAAAGTTTTTCCAAAAAAAAGTCAAAAGAAATGGATGAAGGAATCACACACATAAACGGGGGTCATGGGCACGAAAATAACCAGATGAATAGCAACGACTTAATAAGATTTAACGACGAAGAAACGATGTCAGCATTTTGCGGTCCACAAGGTTCAGGTGATGAATCCCAGCTGATACCTGAAGTTGTCTCACTGCAGGCTGAGCAATCCGATTCCAAGAACCCAAGTGATGGCGGTGTGGTAGTTTATGATGAAAATGATGCAAAATGTATTGGAATGATGTCTGTAGAAGACATTCCGAAGCAAAATCAAGTGGAAAATAGATCAGAAGAGAGTGGTGAAACAATGTCCATTTCCGGTATTCCGAGACTCNAATCCAACGGAACGACTTCTAAACCTACTACCGCTGGCATAAATCCTAGTACAACCAAAGACAAGAAAATGACAAGGCCACTATCAGCACCTCTTTCTAAAGCAGCACCCAACACCACAACAAAGTCTCAAAGTGCAAGACCATCAACAGCAAGACAACCGGAAAAGGCTGGCGGCAAAGCGCCTTCAGTTGTGAAGTCTTCTCGCGATTCAGTATCAAAACCCAGCTCTAAAACAACAGCCAGACCCACAGTAAAACAAACAACAGCGCCATTAAATGGTAAAGCTAGACCAGCTAGTGCTCTGTCAACTAAACAAAAGCCACCTACAGGCTCCACAAGGCCAAAACGTGAGTCTAAAGGAAATGCTAAAAATCYTGTGTCCTTAAAAGATGTTAAGCCTGTTCCTAAAGCAGAGACATCCGCTGATTCGGAAAAYGTGGAGAAGTCGTGTGATCCACAATCCAAAGTYASTRACATAGAATCTGGTGTAGGCAACAATGTTGGCGAAAAAAGTGAAACTGTAACATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9W3Y4	GAS2-like protein pickled eggs OS=Drosophila melanogaster OX=7227 GN=pigs PE=2 SV=2
P11862	Growth arrest-specific protein 2 OS=Mus musculus OX=10090 GN=Gas2 PE=1 SV=1
O43903	Growth arrest-specific protein 2 OS=Homo sapiens OX=9606 GN=GAS2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001140 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00307 all species →	CH	Calponin homology (CH) domain	Domain	Interproscan
PF02187 all species →	GAS2	Growth-Arrest-Specific Protein 2 Domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001715 all species →	Domain	Calponin homology domain	Interproscan
IPR003108 all species →	Domain	GAR domain	Interproscan
IPR036872 all species →	Homologous_superfamily	CH domain superfamily	Interproscan
IPR036534 all species →	Homologous_superfamily	GAR domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46756 all species →	TRANSGELIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0008017 all species →	Molecular Function	microtubule binding	Interproscan
GO:0001578 all species →	Biological Process	microtubule bundle formation	Interproscan
GO:0001725 all species →	Cellular Component	stress fiber	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005884 all species →	Cellular Component	actin filament	Interproscan
GO:0008093 all species →	Molecular Function	cytoskeletal anchor activity	Interproscan
GO:0031110 all species →	Biological Process	regulation of microtubule polymerization or depolymerization	Interproscan
GO:0035371 all species →	Cellular Component	microtubule plus-end	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0051764 all species →	Biological Process	actin crosslink formation	Interproscan
GO:1904825 all species →	Biological Process	protein localization to microtubule plus-end	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24627	GAS2, GAS2L; growth arrest-specific protein 2	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27182.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

70TPM > 0

2Conditions

129.6Max TPM

39.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	29.94	45.75
whole animal · symbiotic	36	36	49.33	129.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	45.75
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	44.44
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.45
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	42.99
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	42.78
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	42.52
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	41.79
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	40.75
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	40.01
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.93
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.69
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.54
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.74
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.77
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.33
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.46
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	30.64
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.84
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.48
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.14
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.12
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.86
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.80
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.62
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.51
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.44
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.17
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.80
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.46
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.45
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.32
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.40
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.65
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.17
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	129.63
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	74.17
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	70.65
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	66.22
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	66.17
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	65.27
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	64.41
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	63.13
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	60.90
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	56.97
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	51.63
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.83
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.12
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.06
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	48.58
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	45.78
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	45.23
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.85
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.61
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.39
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.20
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.04
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.34
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	39.25
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.26
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.95
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.55
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.95
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.99
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.96
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.90
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.52
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.22
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.21
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	33.01
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	31.99

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.