Gene detail

Detailed information of KXJ27332.1 in Exaiptasia diaphana

Genomic Location: LJWW01000021.1:1018771...1032524
NR annotation: KXJ27332.1, Splicing factor 3B subunit 3 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27332.1

ATGCATATGTACGCACTGACCCTTCAACGTGCATCTGCCATCAACAATACCATATATGGCAATTTCTCTGGTTCTAAGCAACAAGAAATAGTTGTTTGCAGAGGAAAATCCTTAGAGCTGCTGAGAACAGATCCCAACACTGGCAAAGTATTTCCTGTGCTTGCTATTGAGATGTTTGGTATTGTTAGAGATCTGATTTCATTCAGATTAACTGGAGGATCTAAAGATTATATTGTAGTTGGTAGTGATTCAGGGAGAATTGTTATTTTGGAATACATTCCATCGAAGAATGCATTTGAAAAGATTCACCAGGAAACGTTTGGTAAAAGTGGCTGTAGGAGAATTGTTCCTGGTCAATATCTTGCTGTCGACCCAAAAGGAAGAGCAATAATGATTGGTGCAATTGAAAAACAAAAGTTGGTTTACATAATGAACAGAGACTCGTCAGCACGTCTTACGATATCCTCACCTCTTGAAGCACACAAGTCTCATACGTTGGCCTTTGATATAGTTGGTGTTGATGTGGGGTTTGAAAACCCAATGTTTGCTTGTTTAGAGATAGACTATGAAGAAGCTGATTCAGATCCTACAGGAGAAGCAGCACAAACCACACAACAAACCCTTACTTTTTATGAACTAGACTTGGGTCTCAACCACGTTGTGCGCAAGTACAGTGAACCATTGGAGGAGCATGGGAATATGCTGATAGCAGTACCTGGTGGCAGTGATGGTCCTAGTGGTGTTTTAGTATGTTCTGAAAACTACCTGACATACAAGAACTTTGGCGATCAACCAGACATAAGAATGCCAATTCCAAGAAGAAAGTATGATCTTGATGACCCAGAGAGAGGCATGATTTTTGTATGTAGTGCAACTCATAAAACTAAGTCCATGTTCTTCTTCCTGGTACAAACAGAACAAGGAGACATATTCAAAGTCACAATGGAAGTCGATGAGGATATGGTGACAGAATTACGCATGAAGTATTTTGACACTGTTCCTGTGGCTACAAGCATGTGTGTTCTCAAAACAGGTTTCCTGTTTACTGCTTCGGAGTTTGGAAACCATTATTTATACCAGATTGCTCACCTGGGAGATGACGACGATGAAGTAGAGTTTTCAAGCACTATGGAACTTGAAGAGGGAACTACTTTCTTCTTCACCCCGCGTGGTCTCAAGAATTTGGTCCTTGTTGATGAACTTGAGAGTCTTGCACCAGTTATGTCATGTCAGATTGCAGATCTTGCTAATGAAGACACCCCGCAGTTGTTTGCACTCTGTGGTAGAGGGCCAAGGTCAAGTCTACGTGTCTTGCGTCATGGTCTTGAGGTGTCTGAGATGGCTGTTTCAGATTTGCCTGGTAATCCAAATGCTGTGTGGACAGTCAAACATACCAGTGCTGATGAGTTTGATGCGTACATCGTTGTGTCTTTCATCAATGCTACCTTGGTTCTCTCTATCGGTGAAACAGTAGAGGAAGTGACTGACAGCGGATTCCTTGGTACAACACCAACACTTTCATGTTCACAGTTGGGAGAAGATGCTCTATTACAGATCTACCCTGATGGTATTCGTCACATCAGAGCTGACAAGAGAGTTAAYGAGTGGAAAACTCCAGGCAAGAAAAGCATCGTCAAGTGCGCTGTCAATCAAAGACAGGTTGTCATAGCRTTAACTGGTGGTGAAGTTGTTTACTTCGAAATGGATCAATCAGGACAGTTAAATGAGTATACTGAGCGTAAAGAAATGTCGGCAGACGTGCAGTGTATGGCGTTGGGACCAATACCACACGGAGAACTCCGGTCSAGRTTYTTAGCTATTGGACTTAGTGATAACACWGTGAGAATCATCTCACTAGATCCTCAGGATTGTTTAACTCCACTAAGTATGCAAGCCCTTCCAGCAATGCCAGAGTCTCTGTGTATTGTCGAGATGGGTGGAGTTGAAGGTGAAGCTGAAGGCTCTAGTCTTGGTGGTCTGTTTTTAAGCATTGGTTTGTCGAATGGCGTACTCCTTAGGACTGTAGTTGACACTGTTACTGGAGACCTGTCAGATACAAGAACAAGATATCTTGGATCTAAGCCGGTYAAGCTATTCAAAGTTCAGATGCATGGCATGGACTCGGTCCTGGCAATGTCAAGTCGTTCATGGTTAAGTTACACTCACCAAAGTCGWGTCCATTTGACTCCMTTGTCGTATGAATCACTGGAGTATGCTTCGGGTTTTGCGTCTGAGCAGTGCCCTGAAGGGATCGTCGCTATATCTTCCAACACTTTAAGAATTCTTGCCTTAGAAAAGTTAGGTGCTGTCTTTAACCAAGTCGCCACCTCACTGAAGTTTACACCGCGTAAATTCGTCATCCATTCCCCTAGCAACAACTTAGTTGTCATAGAAACTGACCACAATGCATACACTGATACAACAAAGGAAGAGAAGAAGCAACAGYTGGCTGAGGAAATGGTAGAAATGGCTGGTGACGAGGACAAGGAAATGGCTGCGCAAATGGCTGCCGAGTTTTTGAATGAAGAAATTTCAGAGCAACAGTTTGGTTCCGCCAAAGCAGGAAATGGGATGTGGGCATCTGCTATTAGAATCCTCGATCCTATAAAGGGAGAATCCACAGACGCGGTTCAACTCGAACAAAACGAATGCGCTGTTAGTGTTTGCGTGTGCTCGTTCAACTCTCGTCCAGACGAGTCATTCGTTATCGTAGGCACTGCAAAAGACATGACCCTCAACCCTCGCTCGTGTGCAGGAGGCTTTTTACACGCCTACAGGATGGCCGAACAGGTTGATGGGACATATAAACTAGAATTTCAACACAAGACGGAAATCGATGATATACCCGGAGCATTGGAACCCTTCCAGGTAAACGTTTTTCTGTTGACTGTCTTTTTATCTTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0JN52	Splicing factor 3B subunit 3 OS=Bos taurus OX=9913 GN=SF3B3 PE=2 SV=1
Q15393	Splicing factor 3B subunit 3 OS=Homo sapiens OX=9606 GN=SF3B3 PE=1 SV=4
Q921M3	Splicing factor 3B subunit 3 OS=Mus musculus OX=10090 GN=Sf3b3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004170 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10433 all species →	MMS1_N	Mono-functional DNA-alkylating methyl methanesulfonate N-term	Repeat	Interproscan
PF03178 all species →	CPSF_A	CPSF A subunit region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018846 all species →	Domain	Cleavage/polyadenylation specificity factor, A subunit, N-terminal	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR050358 all species →	Family	RSE1/DDB1/CFT1/CPSF1	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR004871 all species →	Domain	Cleavage/polyadenylation specificity factor, A subunit, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10644 all species →	DNA REPAIR/RNA PROCESSING CPSF FAMILY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000398 all species →	Biological Process	mRNA splicing, via spliceosome	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005686 all species →	Cellular Component	U2 snRNP	Interproscan
GO:0030620 all species →	Molecular Function	U2 snRNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for KXJ27332.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27332.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

68TPM > 0

2Conditions

74.4Max TPM

32.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	24.61	40.78
whole animal · symbiotic	36	35	39.39	74.36

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	40.78
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.98
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.53
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.40
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.97
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.28
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.52
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.29
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.77
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.42
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.03
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.26
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.09
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.38
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	28.10
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.48
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.19
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.91
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.73
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.95
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.70
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.80
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.11
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.85
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.75
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.72
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.38
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.71
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.98
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.69
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.61
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.89
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.64
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	74.36
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	54.93
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	52.72
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	51.62
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	51.39
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	51.31
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.38
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.32
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	48.63
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	47.47
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	47.19
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	46.61
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	43.91
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	41.89
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.36
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.83
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.80
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.13
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.91
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.65
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.36
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.20
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.69
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.50
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.26
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.23
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.14
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.48
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.29
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	33.35
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	33.32
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	32.82
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	28.56
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.02
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.60
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.