Gene detail

Detailed information of KXJ27365.1 in Exaiptasia diaphana

Genomic Location: LJWW01000021.1:270226...284150
NR annotation: XP_020897708.1, 5'-nucleotidase isoform X1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27365.1

ATGGGCTGTACGATCAGCGCCGAGGCAAAACCGGTCCAGGAATCGAGAGGAGAAAAAAGTTTGGAGCCAAAAGCCAAAACAACTATTACAACACAAAATACATGCAGCAGGTCTTTGAAAACACAACAAACGTCAGAAGTTCAAGCTAAAAAGACTGAAATTATAACAGGACAAAATACAGCAAACTCAAAAACTTCAAACGAAGCGAAAGCCTTTGAGGGGCGACCAACTGAAACAGCTAAAGTTTTAACAATCCTGCATTTTAATGATGTTTACAATATCGAACCACGAGAGAAGGAGCCTGTCGGAGGAGTTGCTAGATTTGCTCATAAACTTACAAGCTATAAAGACTTAAATCCTTTGACTGTGTTTAGTGGAGATGTATTGAATCCATCCCTGATGAGTAGTGTCACAAGAGGAAAGCACATGGTACCAGTTTTAAACTCACTTGATGTCAACATAGCAGTGTATGGAAATCATGATTTTGATTTTGGTGTGGATGAGTTGATTGAATTCAATGAAGCCACAAACTTTCCCTGGTTGATGAGCAATGTTATTGATAAAACATCAAATGGACCACTTGCCGATGGCGATATAAAAAAGATAATAGAATGGAATGGTAGAAAGATTGGATTCATTGGCCTCGTCGAAGAAGAATGGCTTGCAACTCTTGCTACTGTAGACCCCAGTGAAGTCATTTTCCAAGATTATGCTACTCGAGGAACAGAACTTGCTAAGCAATTAAGAGACGACGGAGCTACATTTGTTATTGCTTTAACTCACATGAGGCTACCTAACGACACACGATTGGCACAGAAGTCTCTTGGCATTGATCTGATTCTTGGGGGACATGACCATCACTACGAAGTGAAGGAAGTGAATGGCATTAAGATAATAAAAAGTGGTTCTGATTTCAGGCACTTTAGTGTGATTACAATTTGCTTTAGTGACGATAATAATTTTAATATTGATGTAGAGAAGATTGAAATTACAAGTGACATCCCAGAAGATCCTAACTTAAAAGCCATTGTTGATCAGTACATGGATGTCATGAAAGAGAGCATGGAAGAAACTCTTGGTCAAATAGAAGTTGAACTTGATGGTCGGTTTTCAAGTTTGAGAACAAAAGAGACAAACTTAGGAAACTTTGTCACCGACATCATGCACAACGTGTCCAAGGTTGATGTTGTATTGTTGAACTCTGGTACATTAAGATCTGATGCTTTGCATGCTCCTGGTATTTTTAAGAAAAAGGATCTTGTTGCTATTCTACCAATGCCTGATGCAATGGTTGTCTTAGAATTAACAGGTGAACAGCTCTTGAGAGCTTTAGAAAATGGAGTCAGTCAGTGGCCAAAACATGAAGGCAGATTCCCACAGGTTTCAGGAATGAAGTTTGCTTTTAATCCTGATTGTGAACCTGGTCACAGAATAGTTGAAAATAGTGTTGTCATTGGGGATAGTCCATTAGAACTAAAAAAGCTTTATACTCTGTGCACAAAAAGTTACATTGCAAAGGGTAAAGATGGATATGACGTCTTTTTGGAGTGCAAAGTAGTGGTTGATGAGGAAGATGGCCAGATCATATCAACTGTAGTCCAGAATCATTTTGAATCCATCAACATCTTGAAGGGTGTAAAGTTGTCAAAGTCAAAACACAGACAAAGTATTGTAATGAAACACACTGGTGATTCAAGAGCATCAATATTGGATGCAGAAAAGCATCATGTCATGATAGATCCAAAGGTTGAGGGCAGAATAATCAATGTCAAAGAAATGAAACATTCCCAGCCACAGGTAATTGAGGACACAAATGGAAACCAGGAGACAAGGGACAGCAGTAGTGATGGTGCCATTGATGACAGTGAAGAAGTGACACGAGTCATTCCAGGAAAAGTAATTAGAAATGAAGAGACAGTTGAATCAAATGGTGTTATGGAAAATGGAGAAATTGATCAGACATCTACTGTACAGACAAAGGAAACAAAGCCAGATCTTGCAACTGAGGATGAATATTGGGACTTATGGGAAGCTGTTAAAGTTGATGATGTAAATACAGTCAAAAGGCTACGGGATGGGAAAAATATTCGACTAACGAGACTTCAAGATAACAAAACTATTCTTCATCTGGCAGCTGAACGCAACTCATCAAAGGTTATCGAATATTTATTGACGGAAGGACGGTTGAACGTGAATACCCTTGATGAAATACTGCAGGGAGTGCCTCTGCATGGCGCAGCAGAATATGACAGCATTGACGCAGCAAGAATTCTTCTCGATCACGGAGCAGAGATTAACAAGCAGGACTTGATTGGAAATACAGCTTTACACATCGCATGTATGAATAGCAAGACTAAAATCAAAGACTATCTGTTGTCGCGAGGAGCTGATACTTCCTTGAAAAACTCAGATGGAGACTTCCCATCATTATGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q05927	5'-nucleotidase OS=Bos taurus OX=9913 GN=NT5E PE=1 SV=2
O34313	Trifunctional nucleotide phosphoesterase protein YfkN OS=Bacillus subtilis (strain 168) OX=224308 GN=yfkN PE=1 SV=1
Q61503	5'-nucleotidase OS=Mus musculus OX=10090 GN=Nt5e PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002831 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02872 all species →	5_nucleotid_C	5'-nucleotidase, C-terminal domain	Domain	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00149 all species →	Metallophos	Calcineurin-like phosphoesterase	Domain	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR041821 all species →	Domain	CG11883-like, N-terminal metallophosphatase domain	Interproscan
IPR036907 all species →	Homologous_superfamily	5'-Nucleotidase, C-terminal domain superfamily	Interproscan
IPR006179 all species →	Family	5'-Nucleotidase/apyrase	Interproscan
IPR008334 all species →	Domain	5'-Nucleotidase, C-terminal	Interproscan
IPR029052 all species →	Homologous_superfamily	Metallo-dependent phosphatase-like	Interproscan
IPR004843 all species →	Domain	Calcineurin-like phosphoesterase domain, ApaH type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11575 all species →	5'-NUCLEOTIDASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0009166 all species →	Biological Process	nucleotide catabolic process	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01081	E3.1.3.5; 5'-nucleotidase	EC:3.1.3.5	Nicotinate and nicotinamide metabolism	ko00760	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27365.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

65TPM > 0

2Conditions

60.2Max TPM

16.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	13.02	24.43
whole animal · symbiotic	36	32	19.94	60.19

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.43
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.10
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.93
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.30
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.22
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.57
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.11
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.14
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.12
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.11
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.96
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.80
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.63
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.53
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.55
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.54
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.37
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.24
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.20
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.91
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.86
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.54
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.33
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.15
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.11
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.06
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.81
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.76
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.48
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.04
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.83
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.09
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.78
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	60.19
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	32.21
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	32.02
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	31.23
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	31.10
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.97
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.95
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.57
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.44
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.44
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.32
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.15
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.76
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.61
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.35
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.20
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.61
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.16
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.87
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.83
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.71
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.64
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.47
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.23
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.03
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.58
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.02
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.62
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.60
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.30
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.24
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.35
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.