Gene detail

Detailed information of KXJ27458.1 in Exaiptasia diaphana

Genomic Location: LJWW01000020.1:922969...929639
NR annotation: XP_020897051.1, mitochondrial proton/calcium exchanger protein [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27458.1

ATGGCTTTTTGCAGAATAATAATCCCAAGCCGAGCAAATTTTGCTCGAAACGGTCAAAGTGTGTTGACGTGCTACACAGCTAGTTATTCACAGAGATTCCCTCATATTTTATGGTCAAGGACCTTGGGTTCTACTGTAATCGAAAGAAAGGCATTACCTAACAAGAAACACTGTGATCYCATCAACAGGAATAWAAATAGCACTTCAAAATATCAAAATGGAGATTGGTTATTTAGTGGAGGTCTGACTAAAAGTGAACTACATCAACTTAGCAGATTATCACAGTTTCATTTAGATAGAAGAAAAAATTACAATACCTATTGTACTTTGAATGATACACGCCCACGTCATATTCACYCCAATTACAGCCTAAGTTATGCCACTACCCAGCAGTTACATAATATTGTAACTAGCAGATCTTATCGGACCTTCTCTCCACATCATCTAAGTTTAAAACAAAGCCCTTTATACAATGTAATAAGGACTTTCAAAGGTTCATCAAGCAACGATGAACCAGCTAAAGTCGCCAAGTCTAAAGAAGTTCTCCGTGCWGAAGAAAAATCCAGGGTTGAYGAAGCTGTGGAAGCTATAAAAGAAAAGAAGCAGAAAGTRAAGGACAAGGCTCTTGAGTTTGGTTGTAGTCCTGAAGATTTAGAGCCAAAGGTCCCAGAAGTTGTAGCCAAGAAGACGCTATGGGAAAGATTTAAACTTGAGGTTGTTCACTACTATAATGGATTTAAACTGTTGTATTTTGAAGTTAGAATTGCCATGAGACATTTATGGCAGATTATGAATGGAAAGTCATTGACAAGAAGYGAAAGGAGACAGTTTTTGCGTACAGCYGCAGATCTGTTCAGATTGGTACCATTCCTGGTATTCCTGGTCATTCCATTCATGGAGTTCTTACTCCCTGTGGTTGTCAAAGTCTTTCCCAACATGCTTCCCAGCACATTTGAAGATAAATCAAAGAAGGAGGAAGCCACACGAAAGAAGCTGAAAGTCAAAATTGAAATGGCCAAATTCTTGCAAGATACAGTAGAAGAAATGGCAGTTACTGCAAAGCAATCAAAAACACAAAAATCTGTGGTTGAATTTGCTACWTTCTTTGAAAAGATCCGTACAAGGGGGGAGCAGCCAAGCAATGAAGACATRATTAGGTTTTCTAAACTCTTTGAGGATGAGATAACACTTGATAACATGAGCAGAGGTCAGCTGAAAGCCATCAACAGACTGTTGTCTTTGCAGACTATTGGTACTGATAACTACCTCAGCTTCCAGCTAAGAATGAGGCTACGTCAGCTGAAAATGGACGATCTTATGATCCAAAAAGAAGGTGTCGATGCCTTATCAGGACAAGAGTTGCAATCGGCATGTCAGGCAAGGGGAATGAGGGCCATTGGTGTACCTGAAGCAAGACTACGATCACAGCTAAAACAGTGGTTGGAGTTACATCTTCAAGAGCAAGTTCCCATCTCACTGCTTCTTATGTCAAGAGCACTCTACCTACCGGAGAATGTCAGCTCAGTTGATAAACTAAAGGAGACTCTTTCTCAGCTTCCTGAAACACTGGTTGTTGAAACAGAGATCAAAGTTGCTGAAGTGTCTGGTGAAGAAGTAGACAACAAACGACGTCTAGAAATCTTGAAGAAGGAAGAAGAGTCCATAGCTGCTGAGAAAGAAGCAGTAAAACAGAAAGAGATGGAAGAAATGGAAAAACGAAAAAGGGCTGAAGCTGAAGCTGCTGAAATCCTTGTGGATCGTGCAGAAGTCATTCTCGAGGATGAAGGCATCTCAAAGGCAGATTGGATTACACTAAAGGGWGGCATATCAAACGAACGTGATGTCTTGACCAAGATTAAAGAAGACCGAGAAGAATTTAGAGAGGAATTGAAAGAGTTGGAATTAGAAGATGAAGATAATGCTTTGTCTGAGTCATTGGGATCATCACGCCTTGGTAAAAAGCTCGATAACATGATTACACAGATTGAAGCAAGACTCAAACAGCTTGAAGAGGAATTGATTGAAAGACCAGATGCTTTAAGGATTGATGCTGATGGTGACGGTAAAATCACAACAGACGAACTGATAACTGCAATCCGTAAATTACAACATGCACCAAGTGAAGAGAAATGCAGAAAACTGGCAGACATGCTTGACCAGGACAAGGATGGAAACCTAGACCTTGATGATGTTGAAACGGTCCTTGAATTGCTGTGCATAGAGGATGTTGACTTGACATCAGAACAAGTTGCRGAAATTGTTGCCTTGATTAAAAGAGAGAATGATGCAAAAGATCAAGCAACCAAAAATACTAAAAATATAATGGATAATGAACCCAAAATGTCCCAAGAATCTCAGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZK33	Mitochondrial proton/calcium exchanger protein OS=Gallus gallus OX=9031 GN=LETM1 PE=2 SV=1
Q5XIN6	Mitochondrial proton/calcium exchanger protein OS=Rattus norvegicus OX=10116 GN=Letm1 PE=1 SV=1
Q0VCA3	Mitochondrial proton/calcium exchanger protein OS=Bos taurus OX=9913 GN=LETM1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005050 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07766 all species →	LETM1_RBD	LETM1-like, RBD	Domain	Interproscan
PF13499 all species →	EF-hand_7	EF-hand domain pair	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR033122 all species →	Domain	LETM1-like, ribosome-binding domain	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR044202 all species →	Family	LETM1/MDM38-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14009 all species →	LEUCINE ZIPPER-EF-HAND CONTAINING TRANSMEMBRANE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0043022 all species →	Molecular Function	ribosome binding	Interproscan
GO:0005743 all species →	Cellular Component	mitochondrial inner membrane	Interproscan
GO:0006875 all species →	Biological Process	obsolete intracellular metal ion homeostasis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17800	LETM1, MDM38; LETM1 and EF-hand domain-containing protein 1, mitochondrial	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27458.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

69TPM > 0

2Conditions

83.0Max TPM

24.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	24.61	82.96
whole animal · symbiotic	36	35	24.74	48.72

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	82.96
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.73
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.14
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	30.24
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	28.86
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	28.43
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.16
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.00
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.46
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.37
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.32
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.19
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.27
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.82
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.39
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.29
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.24
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.16
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.56
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.24
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.99
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.67
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.26
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.17
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.86
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.60
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.57
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.13
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.87
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.20
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.73
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.74
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.21
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.08
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	48.72
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	46.52
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	39.37
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.69
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	37.17
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.34
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.93
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.55
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.44
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.70
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.23
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.60
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.98
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.80
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.31
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.20
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.09
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.03
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.75
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.52
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.47
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.29
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.29
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.01
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.44
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.15
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.97
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.83
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.65
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.43
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.12
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.36
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.54
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.49
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.58
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.