Gene detail

Detailed information of KXJ27657.1 in Exaiptasia diaphana

Genomic Location: LJWW01000018.1:742466...747493
NR annotation: XP_020895361.1, exostosin-like 3 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27657.1

ATGACGCGATTTTCTTTTCGCTACATAAAAGACAATCTCTTATTTCGGGTAATTGTTTGTCTCTTAATTTGTGCCATTATTGGACCTTTGATAACGCTCCATCATTTGAACAAGGCAACACTTGTAAAGGGACTTCCTTCATCAAATTCCTTCACTTCCCGTAATACACTTGGCAAAGATGAATTCGTATTGGAAAGATTGGACGAATTGAAGTCACAAATAAATGAATTAGAAAAGATCAAGCTCTCTCTATCCAACGAGCTTCGTGATTTAGAAGGTAAAAGGCATGTTATTCAAAGAGATATACAAAAGTTTCACGAAACAGCTGAGAAACTTAAAAAGGACTCCAAAAAAGTAAAAGATCTTGTGCATCAAGCAAAAAGAGATCTTGACATTTTTAAATTAGAAAAGACTAGATTGAACCAATGTCCACAGCTACCTTTCATGAAACTGCCAAAGGCACCTGACTTGAATCCAATGAGAAAATCATCTTTGAGTCCAAATTTCAAACATCAAAGAGAATGTACTTTAGGAAATTGCTTTGATTATTCCCGGTGCCCTTATTCAGGTGGTTTTTCAGTCTATATCTATAACCCACAGGAATACTTGAGCAAACCGTCTGAAATCATTATCTCAGCTTTTGGAATACTCAAAGAAAGTCCATACTTTACCTCAGAAGCAAGTAAAGCTTGTGTTTATATTGTGATATTTGAGCTTGAAAGACTTGAACTGCCATTTGCTTCTTTGCCTTACTGGAACAATGGACAAAATCATTTCATACTCAAGCTTAAAACTGACAGTAATTATTCAAGTCTTGATTCAAACCTTGGTATGGCATTCATAGGACAGCCATCATTTATTCATTCTAAGTATCGACCTGGTTTTGATCTAATACTTCCACCATTAGTAGCTAATTATTCTGGAGGAAGCTTATGGAAGCATGCTCCTCCACAGCTACCAGCATATAGACAGTTTTTTCTTTCATTTGAAGGCCATACAACTAATCAAAGAGAATCAACAGGGACTAGAGATCTGCTTTCATTATCACAAGAATCAAAGGATTTTCACATTAGCACTAATTGTGGTCATAATAAGCTTTCAAGTAATGATGGGACAGATTGGGGTTTGTGTGGGACCCATAAAGATAGATTAAAAATACTGAAAAAATCTACTTTTACTTTGATTCTTGGTGGACGTACTGCTCAAAGATCATTAGACTCAACACACGTGAGACTTCTTGAGGCTCTGCAATGTGGATCAGTACCTGTTGTACTGGGAATTTCGACTTTACTACCGTTCGCAGAGGTTATAGACTGGCATCTTGCTTCAATAATTCTACCTAGTGCACGTATAACAGAATTAAATGCACTATTGAGGACTATTACATCTCAGGATTTATTAAAACTAAGGCGACAAGGGAGATTTTTATGGGAGAACTATTTAAGTACTCAAAAATCCATCTTATACACTAGTTTATCTGTTATAAGAACAAGACTTTCTTTACCAGCACCGCCATTACTTGCTTCACCATCACCATCAGTATTCACACCATCAAATCAACCAATCAAAAATCCTCCAGATCCTGATGCAATCTTAGAACTCCAAATTAACTCTCCTACATTTACAAGAAATCTTACAACAGCTGTCAACTTTATAACAAATGAATGGAATAGTCCACCCGGGGCTTTATACTCATTTCCGAGCACACCATTTGAACCGATGCTACCATCTTCTGCACCATTTATGAATACAACGGATGCATTTGAGGTTATTGCTGGGGGCAAAGGAGGTTCAGGAGAGCCGTTTAGTAGAGCACAAGGTGGTAACTACCCCAAGGAACAATTTACCATTGTAATGTTGACTTATGAGAGAGAACTAGTGTTGATGGAATCTATACAGAGATTGGTTGGGTTGCAGTATTTGAATAAAGTTATTGTAGTATGGAATAGTCCTGTAAATCCTTCACTTAGTCTCCGATGGCCTGACATTGGTGTGCCACTGAATGTTATAAAGACAACCAAGAATAGTCTCAATAACCGGTTTATCCCGTATGACGTGATTGAAACTGATGCCATTCTGTCTATTGATGATGATGTAGAGCTACGTCATGATGAGATTCTGCTGGCATTCAGGGTTTGGCGTGAGAATCGGGATAGAATTGTTGGTTTTCCTGGTCGATTCCATGCTTGGGATAGCGAGAAGAAAAGCTGGCTTTATGCATCTCGCCATTCTTGTGAACTTTCTTTAATTCTGACTGGTGCAGCATTTATTCATAGGTACTATTTATACCTTTACACACATTGGATGCCAGAAACTATAAGACACAAAGTTGATGAATATATGAATTGTGAAGACATTGCAATGAATTATTTGGTATCTCACATAACAAGAAAACCTCCGCTCAAGGTAACATCACGTTGGACATTTCTGTGCTCATCTTGTCCTGTGGCACTATGGGAAGATAGGACTCATTTTGAGGAGCGTGATCAGTGCATGAATTTCTTCGCCAGAGTATTTGGTTATATGCCTTTACTGAGGACCCAGTACCGTGCAGATTCTGTGCTCTTTAAAACTAGAATTTCGTCTTCAGAGAGCAAGTGCTTTAAGTATGTTTGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O43909	Exostosin-like 3 OS=Homo sapiens OX=9606 GN=EXTL3 PE=1 SV=1
Q9XZ08	Exostosin-3 OS=Drosophila melanogaster OX=7227 GN=botv PE=1 SV=1
Q9WVL6	Exostosin-like 3 OS=Mus musculus OX=10090 GN=Extl3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005811 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03016 all species →	Exostosin	Exostosin family	Family	Interproscan
PF09258 all species →	Glyco_transf_64	Glycosyl transferase family 64 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004263 all species →	Family	Exostosin-like	Interproscan
IPR040911 all species →	Domain	Exostosin, GT47 domain	Interproscan
IPR015338 all species →	Domain	Glycosyl transferase 64 domain	Interproscan
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48261 all species →	ACETYLGLUCOSAMINYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006486 all species →	Biological Process	protein glycosylation	Interproscan
GO:0016757 all species →	Molecular Function	glycosyltransferase activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02370	EXTL3; alpha-1,4-N-acetylglucosaminyltransferase EXTL3	EC:2.4.1.223 EC:2.4.1.224	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27657.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

68TPM > 0

2Conditions

36.2Max TPM

18.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	14.81	22.96
whole animal · symbiotic	36	35	22.76	36.22

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.96
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.01
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.73
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.60
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.14
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.23
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.06
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.74
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.39
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.96
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.82
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.64
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.48
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.46
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.26
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.15
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.93
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.86
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.44
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.80
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.32
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.25
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.23
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.97
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.97
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.69
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.62
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.13
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.63
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.61
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.30
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.85
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.79
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.22
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.74
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.67
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.29
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.07
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.01
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	28.02
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.53
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.48
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.23
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	27.11
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.35
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.39
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.30
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.93
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.71
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.55
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.43
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.94
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.26
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.72
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.68
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.57
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.26
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.04
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.92
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.82
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.58
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.37
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.15
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.60
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.40
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.15
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.67
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.31
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.