Gene detail

Detailed information of KXJ27692.1 in Exaiptasia diaphana

Genomic Location: LJWW01000018.1:77830...85604
NR annotation: XP_020895347.1, extracellular sulfatase Sulf-1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27692.1

ATGAAGTTCTTTTGGTCTTTTGCAATTTTTGTGTTCGTCAATTCTGCAATGGCCAAGAAACGATTGAAGCCCAATATCATCTTCATAATGACTGACGACCAAGATGTCGAGCTGGGATCTATGCGGGTCATGAATCGAACAAGACAGATTTTCAGCGAGGGCGCTGAGTTCGTCAATGCGTTTGTTACTTCGCCAATATGCTGCCCCTCACGATCATCGATCTTGACYGGGATGTACACTCATAACCACAACACTCTTACAAACAACATGAACTGTTCATCAATGAATTGGCGAGTAGGGCCAGAACGACAAAGTTACGCGAGATACCTGGCGGATGCTGGATACTTAACGGGTCATTTTGGTAAATATCTAAACGAGTACGACGGCTCATACATTCCCGCCGGCTGGCATCAATGGATTGGTTTAGTACGGAATTCACGATTCTACAACTACACGTTACGTCACAATACCTTTTTCCGTCGTCATAGAAACAACTACGGTAAAGATTATTTCACTGACGTCATCACCAACCACAGCCTTGCGTTTTTCCGTAGAGCCAAAGCGCGAAATCCTAACAGACCGGTGTTGATGGTTATCAGTCACTCGGCTCCTCATGGACCTGAAGATGCGGCTCCTCAGTATCAAGCTGCATTTAAAAATATCACCGCACCAAGGACTCCAAACTGGAACTACATATCGTTGGACAAACACTGGATCTTGCGTGTAACGCCTAAGATGGATCAACAAAAGATTGCGTTCTCTGATCTGCTGTATCGCAAACGTCTACAAACACTGTTATCCGTGGACGCCTCCATACAACGGGTGTATAACATGCTGAAAGAAACAGGAACACTGGACAATACTTATATCTTTTTGTCATCTGATCATGGCTACCATCTTGGCCAGTTTGGTCTTGTCAAAGGGAAATCGATGCCATATGAGAGCGACATACGTGTACCATTTTATGCCCGAGGACCAAATATACCCAGAAATGCCAAAATTCAACAAGTGGTTCTCAACATCGACCTGGCACCAACCTTCCTGGACATTGCTGGTATCAAGACACCACGAACAATGGATGGAGTATCCGTGATGAAGCTCTTTACCAGGCGACTTAGAAAGCCCAATGACCAGCCACGTGTACGAAGAAAGATCAGCCATCGATGGAGGGACACTTTTCTTATAACACGAGGAAAACCCAGGCGAGGTAACAAGCATCGTGTAACAAAAAAGCAGCCAAAATCAGCAAAAGCCACGTTCCTCGAACGATTATGCGCAGAATCCAAGTATCGGTCACCCTGTGTAGCAGGACAACAATGGCACTGTATCAAAATAAAAGGCCGTCTGAGATTGAAGAAATGTAAGAAAATAGAGCAATTACCAGTACATCCAACCACGCCCACCGTAGAAATGTGCACGTGCTATCGGCCTAGACTACCATGGGTGAAACCAACTAAGGAACAACCACCACGTGATGACGAAAACAACAAGGAAAAGTTGCAAAAACGTTCATTGCGTTCACAACAACGACGAGCTCACAAGCAAAGCAACTACTACAAGGAAGTGTCTCGTGCAATGAAGATGGCTGCACGACGTCGAAAAGCTAAAATGATGAACATGAAGCCATTAGAAGAAAATGGCGATGTCGAGATTGACAAGAGACTAGAACGTATAAATGCAAAGATTGCTGGCATCAAGTTTCGTTTAGAAGCACTTAGAGGAAGGAAGAAGAAGTTGATAAGAATCAAAGAAGAAAAAGATACAGAGAATTACTTAAAACAAAAGTACGAAGAGTTTCCATGCCCATGTCCTACCCCATCACAGCCTGCAAAGTCAAGGAGACCAAGAGGTGGTAGCAAGGCAGGAAGATTACGTCGAAGACTGAGGTCAGGCGCTATCAATTCAGAGGTCTATAAGAAGCGACTACAAAGAAGAAATAAGAAAAAGAACAGTTTAAAGTCAAGTCTTCGTTCTGGCAAGAGAAGAAAAAAGACCACTAAAAAGAAGTCCAGGCGAACCAAATGTTCTGTTCCGGGGATGAGCTGCTTTTACCAGACCAACTATCATTGGAAAACACCGCCATTGTGGAATGGAGGAGAGTTCTGTTTTTGTCCAAGCTCAAGTAACAATACATACTGGTGTCTGCGAACCATCAATCAACATCAGAACTTCTTGTATTGTGAATATATTACACAGTTTCTGGAATACTTTGATCTGAATACTGATCCTTACCAGCTTTACAATATAGTCGATCGTATTAGTCCTTCAGTCTTGTACGATCTCCACCATCAATTAGAAAGACTAAAAGGCTGTAAAGGGTCTCATAGTTGTACTCAATATCATGGAAAACCATACAAAAAACCTGACCAGTCTGTCAATAGCACCAGTAAACCGGTTACGAAGACAAAGATTACGGACAAGAAACCAACAACAACACAATCACCAACAAAGCTGCAAGATACAAGCTATACCGAAACAACCCCCAAACCCACCAAATTGTTGGAAAAGATTGTCGACAAAAGTGATGGACAGTCTAACAAAGAAGCAAATAAAAATACAAATAAAGAAATGTTGACTGAAAAAGGGAAAATTGAGAAAAAAAAGCGAGGAAAACAGAAAAAAGACGGACTTGCTCCAACTCCAACAACCAACGTTAAGAAGGCCGAAAAAAGTAAAAGTAAAGCCGAGAAGAAAAAGAAGAGAAACCGTGGAAARAAGACAAACAGACGTGTGAATGGAAACAAAAGAGACAGTTTTACCACCGTATCGCCATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IWU6	Extracellular sulfatase Sulf-1 OS=Homo sapiens OX=9606 GN=SULF1 PE=1 SV=1
Q8IWU5	Extracellular sulfatase Sulf-2 OS=Homo sapiens OX=9606 GN=SULF2 PE=1 SV=1
Q90XB6	Extracellular sulfatase Sulf-1 OS=Coturnix coturnix OX=9091 GN=SULF1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002010 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00884 all species →	Sulfatase	Sulfatase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017850 all species →	Homologous_superfamily	Alkaline-phosphatase-like, core domain superfamily	Interproscan
IPR024607 all species →	Conserved_site	Sulfatase, conserved site	Interproscan
IPR000917 all species →	Domain	Sulfatase, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43108 all species →	N-ACETYLGLUCOSAMINE-6-SULFATASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005539 all species →	Molecular Function	glycosaminoglycan binding	Interproscan
GO:0008449 all species →	Molecular Function	N-acetylglucosamine-6-sulfatase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14607	SULF; extracellular sulfatase Sulf	EC:3.1.6.-	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27692.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

68TPM > 0

2Conditions

86.7Max TPM

48.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	41.69	65.44
whole animal · symbiotic	36	34	55.69	86.65

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	65.44
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	64.03
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	61.65
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	60.77
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	60.41
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	59.58
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	57.72
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	53.20
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	52.61
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	51.65
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	51.54
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	50.19
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	50.16
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	48.77
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	48.35
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	46.96
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	46.45
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	45.91
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	45.12
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	44.71
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	44.18
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	41.10
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.40
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.23
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	34.54
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.59
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.12
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.02
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.05
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.90
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.75
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.24
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.82
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.52
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	86.65
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	84.75
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	83.39
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	80.56
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	80.48
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	79.43
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	79.29
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	77.03
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	77.00
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	73.36
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	72.47
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	69.05
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	66.97
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	60.54
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	57.54
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	57.44
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	55.98
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	54.92
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	54.02
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.68
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.39
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	50.18
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	49.35
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	48.43
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	46.77
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	45.34
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	45.01
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	44.41
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	44.08
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.99
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	42.34
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.78
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	32.43
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.88
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.