Gene detail

Detailed information of KXJ27693.1 in Exaiptasia diaphana

Genomic Location: LJWW01000018.1:72827...77242
NR annotation: XP_020895349.1, pseudouridine-metabolizing bifunctional protein C1861.05 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27693.1

ATGCATATCAAGAAGCTGTACAACATTGTTCCATATTCAAGACATGTTCTTATGCAGTGCCGAAKCTTTAGTRCTCTTGAGCACAGTCCTCTTGGTACTGGGCCAGTACACCAAAAACACAAACAGAATAGTTCATTGTTGCAAATTGCCSCAGAGGTTGCAGATGCAGTTGCAACTAATAAACCAGTAGTTGCTTTAGAGTCAACMATAGTGACTCATGGTATGCCATACCCACAAAACCTCAGTGTTGCCAAGAAAGTGTCAAAGATCATTCGAGAGAATGGTGCAATTCCAGCAACAGTTGCTGTCCTTGATGGCTGTGTCCATGTTGGTATTTCAGATAGGGAACTAGAAGGTCTAGCGCATCCTGACAGCCTCTCCATCAAAACGTCAAGACGAGATCTACCATATATTCTAAGTCAGGGATTGTCTGGTGGAACTACAGTGTCTGCTACCATGATTGCAGCAAATAAAGCTGGCATCAAGGTTTTTGTTACTGGTGGAATTGGAGGAGTTCACAGAGAAGCACAAACAACATTTGATATCAGTGCTGATTTGACTGAACTAGGCAAGACACCTGTAGCAGTAGTATGTGCAGGAGTAAAATCTATCCTTGATATTGGACTGACCTTGGAATATCTGGAAACACAAGGAGTAACTGTTGCAACATATGGTCCAAGCAATGATTTYCCAGCATTCTTTACAGCTAAAAGTGGTTATAAGTCTTGCTGCTCAGTGAAGAATCCTTTGGAAGCAGCCAAACTTATTGACAGTAGTTTATCACTTGGGCTACAGAATGGCATGGTGATTGCTGTTCCTGTACCTGATACTGAAGCACTGTTAGGATCTAGCATTGAAAGAACTATTCAACAAGCCTTAGAAGATGCAAGGTCATCCAATGTTCTTGGAAAAGAGGTGACCCCATATGTCCTTAAAAGAGTTAATGAACTTACAGATGGAAAGTCTCTGGAAGCTAACATTCTTTTGATTAAGCATAATGCTAGAATAGGAAGTCAAATTGCAGTAGAGCTGGCTAAAATACATGAAAAAAGAAAAAAGAAAATACAGCAAGAAAGCCTAAATAAAAGTGTATCATTCAAGGAAGATGAAAAATCTCTATCAAAGAAAAAAACCTCTACTGGGCGACCCGTTGTCATTGGTGGATCAAATGTAGATTTTGTTGCTACAGCAGAAACTATTATTCCTGAGGCTTCGAATCCTGGAAAGGTGCAGATCAGTTTTGGTGGAGTTGGCAGAAATATAGCAGAGGCTCTATCTCGTCTTGGAAAGAAGCCAATATTTATTTCTGCTGTTGGTGGGGATGCACTGGGAGCAATGATGTTAAAACATTGTCAAGAATCCAATATGGCAACAGGAGGAATTCATACTTTCAATACTTGTCACACRGCCACATATTCAGCTGTACTGAGTAATTCGGGTGATTTCAATGTGGCAGTTGGTGATATGGACATACATCACAAAATCACTCCCCAAATAATTTCAGGTTTTGAGGAATCTATTAAAAATGCGCCATTGGTTGTTTTTGATGGAAACCTTAGTAAAGAAACAATGGAAAAAGTTATCCTTCTTTGTTCCCACCATGGTGTGCCAGTCTGGTTTGAACCAACATGTATGATGAAGGCTGGTCTGCCTTTCCAAACAGATACCTGGCAAGATATCACATACGCTTCGCCAAACATGAATGAACTTCGTACAATGAGTGACACTGTTGTACAATTTCATCACCTACCACGACATCCGCGGGTTGATAACTGGAAACYACGGGAAACATCCATCGATAATATCATTGATGAGTGTATTCTATTTTCTCAACCTCTCTTGACTCGTATTCATTGTTTGATTATTACACTTGGCAAACATGGCGTTCTTGTCTGTCGTAACACAAACGCTGACCATCCCTTCCCAACATCTCGGAATTCACATCTGCCAAGCAAACATAATCACTTGGTGTCAGCCGTTCACTACCCAGCTCCTAAAGTAGACGATGTTATCAATGTTACTGGTGCAGGAGATAGCCTTGCTGCTGCCATGGTAATGTCAATCATTAAAGACCACGCCCCAGAATTGTGCATCAAATTTGGTTTGATGATGGCCGTGCATTCCTTGCGATCACGTGATACTATAKCTCAATCTATGACGGCACAGGATTCAACTCAAGCAGCAACCCTAGGAGATTTTTATGGAAAATTGAACCCAAGACTAATCGATGTGTCTCATCTACGATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
C0ZIY1	Pseudouridine-5'-phosphate glycosidase OS=Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599) OX=358681 GN=psuG PE=3 SV=1
A7GCK7	Pseudouridine-5'-phosphate glycosidase OS=Clostridium botulinum (strain Langeland / NCTC 10281 / Type F) OX=441772 GN=psuG PE=3 SV=1
Q84K35	Pseudouridine-5'-phosphate glycosidase OS=Arabidopsis thaliana OX=3702 GN=PUMY PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004160 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00294 all species →	PfkB	pfkB family carbohydrate kinase	Domain	Interproscan
PF04227 all species →	Indigoidine_A	Indigoidine synthase A like protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007342 all species →	Family	Pseudouridine-5'-phosphate glycosidase	Interproscan
IPR029056 all species →	Homologous_superfamily	Ribokinase-like	Interproscan
IPR022830 all species →	Homologous_superfamily	Indigoidine synthase A-like	Interproscan
IPR002173 all species →	Conserved_site	Carbohydrate/purine kinase, PfkB, conserved site	Interproscan
IPR011611 all species →	Domain	Carbohydrate kinase PfkB	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42909 all species →	ZGC:136858	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004730 all species →	Molecular Function	pseudouridylate synthase activity	Interproscan
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16330	K16330; pseudouridylate synthase / pseudouridine kinase	EC:4.2.1.70 EC:2.7.1.83	Pyrimidine metabolism	ko00240	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27693.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

66TPM > 0

2Conditions

31.3Max TPM

16.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	13.62	30.67
whole animal · symbiotic	36	32	18.41	31.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	30.67
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.87
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.83
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.58
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.77
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.80
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.69
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.96
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.86
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.64
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.56
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.17
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.88
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.70
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.34
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.85
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.50
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.50
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.33
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.08
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.04
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.04
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.99
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.83
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.77
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.51
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.41
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.25
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.90
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.81
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.03
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.80
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.28
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.22
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	31.27
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.32
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.97
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.87
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.65
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.91
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.90
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.46
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.57
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	23.22
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.86
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.42
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.58
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.63
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.33
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.24
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.04
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.79
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.23
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.95
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.78
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.64
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.39
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.79
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.39
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.79
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.70
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.70
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.63
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.44
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.97
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.36
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.