Gene detail

Detailed information of KXJ27850.1 in Exaiptasia diaphana

Genomic Location: LJWW01000017.1:167674...174738
NR annotation: XP_020894557.1, protein kintoun [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27850.1

ATGTCTGCAAGTAGAAAAGAAGAAGACTTTGAAATCACGAAGGAGGAGCTTGACAAGTTTCAGAAAGCTATGGAAAATGAAGAGTTTCGCAAGCTGCTTCTTGAATATGCTCAAGAAATATCAGATCCYGAAAACAAGAAAAAATATGAAGAAGAAATTTYACAGATGGAGAAGGAAAGAGGGATGGACATTAAATTTGTCAACCCAGAGGGTGGGTTTGTGGTCAAAACTACCAGAGTCAAAGATGGTCTCAAGGCTTTTGTAAATATCTGCTACAATGAACATGTACAAAAAGCTTCCTCTCAATATACAGAAAAGGAAGAGAATGGTATAAGGAAAAAAGGTGAGCAATGGAGTATACCTTTCAGCCTGTCACAACCAAGAGATGATTTTGATAATGCTGGTAAAAAATGTGTGGTGTTTGATGTAGTGTTCAACCCAGAAACTTACCAAAAAGGCCAACAGGAGCCACGTTTTAAAGAAACAATGATAAACACAGCACTGGATGGAATTCAAAAACAACTTAATGTCAAATTGAATAATAAAAATTTAAAGTTTCCCAAGTTAAAATTYAAAGGTGTAAAGCAGGCAACAGTAATCAGAACCAAAAGTAAAGATGAGCAAACACAAAAGGTTGCWGACAACAATGTCAACATTGRAGGACAATCATTCCCTTATCCCTACCCTAGTGAACCCCTTCATGATAATAAAAAACATAAAGCAAAAACCAATACTATAATAGAGAATGATAGTAATCAAAGCAAGGAAGAACAGCAACCTGAGACAAAAAATGAACCAGTCTACAGCATTGTACATCGTGGAGTCATTGATTTCCAGAATTTTACCAATGCCAGAGATTCCTGTACCAGTACCAGACCAAAGGAACTTGTTGTTACTATTCAACTTCCAAAATTGAAATCTACAGGAACTGTTGAGCTTGATATAAGTGAGAAGCAGCTCATCTTACACAATGATGAACCCATTTACCATCTAGATTTAGCTTTACCCTACACTGTTGATGAGGCTAATGGTCATGCCAAGTTTGACAAAAGTAGACGAGAACTTGTTGTAACCTTACCAGTCCTTGCAATTCTTCCTCATGATTATCCTACAATCACTAATGAAACAACAAACAAAGTACCAGATTACCAGGATAACAACAAAACTGATATCATAGACAATGCAAACTATGATATAMAAACAACAGATATCACTAACAATGATGATAAATCTAGTGACTTTAATTCTATGGGCAAAGAAGTAGAGTCCAATGAATTTATCAACGGAGGTGTAGACATTGAAATAAATAAGACACAGAATGMTGGAGAGACCTTAGATTCAACAAGTGTCGAAGGGTTTGTACTCATGGATGATATTATACAAGTAGATCAAACTGATGAAGGATTGATGTACACAACAACAGAACTAAACTCCCAGGATTTGCAGTTGGAAATAACTTCAGATCTTTCAGATATGTCCTCTCCTTTCTTCTTCAAGTCACCACCATACACKTACCACCAAGACATGGATACGGTGACATTGGTTGTTCATGTTCCTGGGGTTGCTATGGAGAATGTCTCCCTTGGGTTTAATGAGAATAAGTGTTACATCAATTTTCCATCTGAGAAGGCAACAACTAATCAYCTACCAGCTCCAGACTACGCCTTGTACATCACATTTCCTGAAGGACATGATCTTGCTGCAGATAACTGTCACATTGATGTAACTGAGGACAACCTCGTACTCACCTTGGCAAAGGATGATGCTTGCAAAGGATTGTGGGATGGATTTAAAGCGGGACCTGGAGAGGAGGAACTGGAGGATAAGTTTTTTATCACCGATAATAATGTTGAATTAATGATGGAAGAAATAGCCGAGCAAGACCCATGGGCCCAACAAACATGCTACTCATCAGATGTCAAAGTCCTTTCAGTAGCAGATGATCAGTTGACTGTTCAACTTCGCGAAAATCGTTCAGACGCCGATGACCAGGATACTCCCATAAACGGCCACGTGCACCAACAACACAAAGGTCAACACAAAGACATATCCAATAAAAACTCCATGGAATCCGTAAAGCTCGAGAATCTGGATTTGAAAGAAGGAATTTTGTCCAACAAGATGCAGGAATTAAAATTACAGAAATTAACGAGTCCTGATGAAGGAATAGTACACGATATGTACAGCCATGAGAGACGTGAAAAATACTCGTATGGATTAACAGAACGTATTGCTGCCTCGACGGACCCTAAATTAGTCCAAGATCACGGTCATAAAACAAATACCGACGAAAGACGAAAAAATCGGTCAGATAGTACTGACTCAATATCTTCCGACCGGTCAGATTCATGCGACGGACGGCGGAAGAGCCGGTCCGATAGTTTGGACTCAGTATCATCCGATCGGTCGGATTTGACATCGTCCAATACTATTCCTGCCAGAAAGTCGTGCATGCGCCGTAGTTCCAGCACCTCAACTGATGATGACACTGATTATGAAATAAACAACGCAATGTCTCCTAGCAACGGGTCGTGGGGATCTCCAGGGAAACGTAATGTTCGTTTCAACCTTAACCCAAGTGTTCGCGTGTTTAGTAATAAAAAAGATAAGCAAAGATGGAAAATGGAGCAACGACTGAAAAAYCAAAAGATCTCTATGCGCGACAATGGTGAAGACAAAATTGAGAAAGAAGCAACCATTCATGAAGAAGGAAGCGCCTGGCAAGACGAAGTGGAGCCGAACATTACAACACGTCAAGACAGTGAAAGCAGTGTGGATGATGAATGGACAATGGTAGATAAACCTTCAGACAGTAGCTTGTCAAATAATTTAATTTTTGAGCTTGATGAGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B1H1W9	Protein kintoun OS=Xenopus laevis OX=8355 GN=dnaaf2 PE=2 SV=1
Q0P4V4	Protein kintoun OS=Xenopus tropicalis OX=8364 GN=dnaaf2 PE=2 SV=1
Q5FVL7	Protein kintoun OS=Rattus norvegicus OX=10116 GN=Dnaaf2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004810 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04969 all species →	CS	CS domain	Domain	Interproscan
PF08190 all species →	PIH1	PIH1 N-terminal domain	Domain	Interproscan
PF18201 all species →	PIH1_CS	PIH1 CS-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR034727 all species →	Family	Kintoun	Interproscan
IPR008978 all species →	Homologous_superfamily	HSP20-like chaperone	Interproscan
IPR007052 all species →	Domain	CS domain	Interproscan
IPR012981 all species →	Domain	PIH1, N-terminal	Interproscan
IPR050734 all species →	Family	PIH1 family, Kintoun subfamily	Interproscan
IPR041442 all species →	Domain	PIH1D1/2/3, CS-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22997 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0070286 all species →	Biological Process	axonemal dynein complex assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19751	DNAAF2, KTU, PF13; dynein axonemal assembly factor 2	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27850.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

64TPM > 0

2Conditions

27.0Max TPM

14.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	32	12.66	21.24
whole animal · symbiotic	36	32	15.65	26.95

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.24
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.73
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.19
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.54
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.31
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.77
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.73
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.48
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.27
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.20
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.18
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.05
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.32
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.38
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.21
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.00
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.86
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.80
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.59
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.05
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.70
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.20
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.91
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.59
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.00
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.96
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.75
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.65
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.06
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.84
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.12
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.00
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.95
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.46
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	26.28
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.41
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	24.67
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.28
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.69
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.40
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.89
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.35
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.02
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.50
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.47
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.05
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.76
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.50
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.48
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.44
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.43
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.10
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.57
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.12
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.11
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.10
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.67
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.44
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.18
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.47
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.16
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.12
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.61
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.81
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.