Gene detail

Detailed information of KXJ27891.1 in Exaiptasia diaphana

Genomic Location: LJWW01000016.1:573032...579611
NR annotation: KXJ27891.1, Pectin acetylesterase 5 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ27891.1

ATGGTCATCGCCAACGCTGATACTTTACTTAATATGGGGTGGTTTTCCACTGTTGCATTTTTATTGCTAATTGGGMCTTCTATGCAAGCCCCTAAGCCCAATAGCATAGACGGTGAARCAACTAATCGCCTTCAAAACCATGATTATGAGCAGACTAGTCATGTGGAAGACGAATCAGCAAGTAGTTCAGCCAGCTCAAGCATCGATCAAGATGACCTACAAGGACACACTGAATCGTCAAGCGATGATCCAGAAGAAAATGAGGGTTCAAATGACGACGATGTCGATTCTGTGGGCTCATATATTAAAAAGAGTGCCGTCAGAAGGGCACCACAAACCAACCCTACAAACATTGACTCCGATGCATCTTACATTTCACGCGAAGATCAGGACGATGGAACCGTTCGCGATGCAATACTTGGGAAAAATAACGATAATGGCGATAATGATGACGATAAAAATGATGATGAAGATGATGCTGGCAGTAACCGTGATGAAGCGACATCAACATTACAAGGAGATTCTGTGGCGTCGTACATCAAACAGGAAAATGGATATACAAAAGATACAATAGGTAGTGCAAAGCCTTTAGATGAGGACTCGGTAGCGCCTTACATTGCTATGAATAAAGGATCGCCCAGACATTCCATACCACAATCAGATCATAATAATCCAACAATAACACTCAAAAAATCGAATGCCCTAAAAGGTTTGGAGGGAGATTCAGTTGCGCCTTATATTGACATAGGAGATGGATCATCTAGAGATACTATACCGTCACAATCTAATCCCGATATAAATGAACCTATTTCACCAAAAACAGACTCTGTAGGCCCTTATATAAGCCTTGTAGATGAGGACAATCAGCAATCGGATACAGAATCCTCCACTCATAGTGAAGGAAGCGGTGAGGTACAAGAGCTGTCCGGAGATTTGGATTCTGAAGACCATAAGTCTCGCAAGACCCAGGAAATCCTTCAAGGTCTGGAAAACATATCAACAGAGGAAAGAAAAGTAGTGAAAAGTTCGAAAATGGATCAGTTAAGTCCAGATGTCATTAAACCCCATCAAATGGTGTCAGAATTTTGGCTGGAGAGATCAGCTTTTTCATCACCGACGCCACAAATGAGCAGTACACCATACGATGACGAGCCATTTAATGACCAAACGATGTTCACCCAACCTCAATACATCTATGTAGACTTAAAACAAGCAGATCAAAAAGGAGCAGTTTGTTTAGATGGCTCCACCCCAGGGTTTTTCTACAGGCAAGGTTTGGGTAGTGGTCAGAAAAAGTGGATTATATACCTCCAGGGAGGAGCATGGTGTCATTCTAAGATGGATTGCTATGAACGCAGTCAATCAAACTTAGGCTCCTCTTTGAAATTCAACACCCTTATCAACGTCGAAGGACTTCTGAGTCGCGATTTCAAATCAAACCCTCATTTCTATGACTGGAATGTTGTGTATGTACCTTACTGTGATGGTGCATCCTACACAGGGAACCGTACCAAACCCGTCGAAATCAAAGACAAGATGATATACTTCAGAGGAAAGAGAATTCTCAGTTCTTTAATGGATGATTTGCTAGGGTATGGAATGAACGACGCTGAAAACGTTGTCTTCTCAGGCACATCTGCCGGTGGTTTGGCAGTTCTCCTACATGCAGACTACGTTAGAAGCCGCATCCCCTCGAAGGTTAATGTCTATTCTTTAGCAGATGCAGGAATCTTTTTGAATGTTGCTAACATGAAAAAGAAAAATCAGTTTGGAGATTTAATGTCAAAGGTTTACAAGCTACATGGTTCATCTAAGTCGATCAAGCACAARTGTGCAGTTCATGAAGGCAGAGGCAACCGCTGGAAGTGCCTCTTTCCCTATTACTTTGGAAAGTACATCGATTCTCCTGTGTTTGTCATCAATCCACTTTACGACTCATGGCAGCTGGGAAATGTAATTGGAATCCATTGCACTAAAAATCTTAACAAATGTTCCAAGAAAGAAATGAGAGCCATAATTGACTTTCGAAAAAGAACTCTAACGGCCTTAGAACCTTTAATGAAAAATCCAAACGTCACCCTTTTTGCCGATGGCTGTTTTGATCATGGGCAAATTACGTTTGGACCCAAATGGAATGAGATCCGCGTAAAGAATCGTTCAATGTCCGGGTCTTTTGCCCGTTGGATGCWGAAAGAAGAAAATACAAGAGCAATTGTGGATCCTGAATTAGAAGATCAGCTTTTTAACCCTACATGCGTAACGCATAACATAAAGATCTCCAAAAAGTCTTTTACTAATGATTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9SR22	Pectin acetylesterase 5 OS=Arabidopsis thaliana OX=3702 GN=PAE5 PE=2 SV=1
Q9FH82	Pectin acetylesterase 11 OS=Arabidopsis thaliana OX=3702 GN=PAE11 PE=2 SV=1
F4I839	Pectin acetylesterase 2 OS=Arabidopsis thaliana OX=3702 GN=PAE2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002059 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03283 all species →	PAE	Pectinacetylesterase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan
IPR004963 all species →	Family	Pectinacetylesterase/NOTUM	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21562 all species →	NOTUM-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19882	NOTUM; O-palmitoleoyl-L-serine hydrolase	EC:3.1.1.98	Wnt signaling pathway	ko04310	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ27891.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

67TPM > 0

2Conditions

65.6Max TPM

14.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	33	16.07	65.60
whole animal · symbiotic	36	34	12.74	35.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	65.60
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	28.11
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	27.61
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.99
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	24.87
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.25
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	20.70
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	19.36
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.08
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	18.00
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.96
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.80
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.23
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	17.18
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.60
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	16.31
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.85
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.59
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	15.58
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.94
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.71
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	14.43
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	13.71
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	12.68
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.84
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.78
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.40
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.90
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.12
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.17
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.71
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.47
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.17
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.69
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.12
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.34
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.64
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.20
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.72
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.59
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.02
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.42
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.22
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	15.17
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.27
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.19
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.38
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.13
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.10
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.03
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.86
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.84
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.74
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.69
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.73
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.57
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.33
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.08
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.44
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.34
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.27
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.26
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.71
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.58
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.23
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.70
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.01
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.