Gene detail

Detailed information of KXJ29892.1 in Exaiptasia diaphana

Genomic Location: LJWW01000002.1:888098...908256
NR annotation: KXJ29892.1, von Willebrand factor A domain-containing protein 5A [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ29892.1

ATGCGTTACGGATTTATCAATAAAAATGGACCCTCCGAAGTCCCTCTGGAGAAGATACAAATCCAAAGCTCCCTCAAAGGTTTCACAGCCGAAGTGGTCGCGAYCATGGAGTACAAAAACAATTCTGATAATCCCATAGAAGCCATGTATGTSTTTCCAGTCGACGAGGAAGCTGCCGTGTGTGGATTCCAAGCCACTATTGATGGAAGAACTATCGTAGCTGAGATCCAAGAAAAGCAAGAAGCCCGAGATACGTACGACGATGCCATCAGTAGTGGACATWRKGCATTTCTACTGGAAGAGAGCGACGAGAGTTCGGACATCTTTCAGATCAATGTGGGAAACTTGCCGCCACACCAGTCCGCTAGCATTGAGCTGACTGATGATGATGACCTATCTAATGGAGAAGAGTTTTATGATGACACCATAGCACGAGCAGCAGCTGTACCGAGAAGTATGAAGATGGCGAGTTTTGSTTTGTCGGATCTTGACTGTGACTACGAGCAGTGTGCTACTGCATCATTGCCTGTACGTCGCCATGCGATGGGCTTGCCTAAGAGAGCAGCACCAATGAAAAAAGGTTTTTCTTTTAGCCCATTTTCAGGATTCTTCAAAAGTACATCTCTGAGAAAGAAAGCTTGTGAACCCTTGTATCAGACGAGATCTAGATCCAAAGGAACGAAAGAAACTAATGAATACGATGCAACCATCGAAGATTGTTTCTCTAGTGACCTCTATTATGACATGGAGATTGAAGAAGCGTATAATCTGAAAGACGCTCGTGAGGACTTCCCTCAAGGCCACAACATGGCTTCGAAAACGAGCTGGAAAAAAAAGATGGAAATGCGTTACGGATTTATCAATAAAAATGGACSCTCCGAAGTCCCTCTGGAGAAGATACAAATCCAAAGCTCCCTCAAAGGTTTCACAGCCGAAGTGGTCGCKACCATGGAGTACAAAAACAATTCTGATAATCCCATAGAAGCCATGTATGTGTTTCCAGTCGACGAGGAAGCTGCCGTGTGTGGATTCCAAGCCACTATTGATGGAAGAACTATCGTAGCTGAGATCCAAGAAAAGCAAGAAGCCCGAGATACGTACGACGATGCCATCAGTAGTGGACATWRKGCATTTCTACTGGAAGAGAGCGACGAGAGTTCGGACATCTTTCAGATCAATGTGGGAAACTTGCCGCCACACCAGTCCGCTAGCATTGAGCTGACGTTTGTGACTACCCTCAAAGTGGAGAAAGAAGGCAAAATAGTGTTTGTGCTCCCCACTGTCCTCAATCCAAGATATACTCCAAGTGACTGCAACGCCAGTGTCAGTACCACTATGGACAGCCTCGCATCAGTCATTAAGGTTCTCAAGAATGCCCTCCAACCTACCCTTCTTGACTGCGAAGTGACGTGGCCTAAAGAGTACAGAGTCCAGACAATCCCACGAGAACTACCACCCATCTTCAGTGGTAACAGTCTTATCATATATGGCTTGGTGTCTGGTAATGCAAGTGTCAAGGGGTATGTTACTGTTAGCGGTGATTTGKCAGTGGGATCGACAGATAGAAAAATCGAGCACAAAGTCAGTCTGGAAGCCCTTAATTCAAACGACAATAGCTACCTCCTTCATCGTCTTGCAGCAAAAACCCTTATCAAGGAGAAACAAGACGCTGACAGGTATGCAACGAGTGGGGACATAGTGAAAGTTAGCAAATCAGCCAATGTTGCGTCGAAATTGACGTCGTTTGTAGCTGTGGACAAACATAGCAAGAAACCAATTTCTTATTCGTTGGCTTCACCTAACTATCAAGGAACTATCGAGAACTACATATTGTATAAGATCGAAAAGAACGCTGTGTTTGAGAGCATGGATGCACTTTCTGCGCGGTGCAGCTTGACTAACGAACTTCGATGCCAAAAAAAGACGAAGGCTTTCCCAAATCCTTTATCATGGTTTGGCAGCTTCTTCAGTTCATCGACGTCTACAAAATCTGCAAAAACAAAGAGTTTTGATGTACTCTGCGACGCCCCACCTACTTACAGTGCTATGACTGCTACACCAGTTCCAGCGGCGGGAGGGCCCAACACACTGACTATAACTGAGTCTGCTGGGCCAAGTTTTCTGTCTAGTGATCTGTTGAATGATGATGAATCAGACGAGACACCACCTCCATACGAGGCAGGCGAGACTATGGCTTCGAAAACACAAAAAAACTGTCTTGAGATCATTTCCCTTCAAAAAGCATCAGGAGCATGGGAACTTACCGCTGAGCTGGCCAGTATCTGTGGCTCACTACTGGACGAGCTCAAACAAAGGTGTCCATCCCAGCTAACCACAGGAGACAAGGATAGTCTGTGGGCTACGGCCTTGGCGTTAGCTTGTCTTAATGCAAAGTTTTCTCATCAAAAAAATGAATGGGAGATGGTTGCAGAAAAGGCGAACAAGTGGCTGAAGAAAAAATTGCCCGAAGATATCTTAAGCTTTGATGAAATCATGGAAAAGGCGGCCGGCGCATTGGAGATGTAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q75WE7	von Willebrand factor A domain-containing protein 5A OS=Rattus norvegicus OX=10116 GN=Vwa5a PE=2 SV=1
Q99KC8	von Willebrand factor A domain-containing protein 5A OS=Mus musculus OX=10090 GN=Vwa5a PE=1 SV=2
O00534	von Willebrand factor A domain-containing protein 5A OS=Homo sapiens OX=9606 GN=VWA5A PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001087 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08487 all species →	VIT	Vault protein inter-alpha-trypsin domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013694 all species →	Domain	VIT domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45737 all species →	VON WILLEBRAND FACTOR A DOMAIN-CONTAINING PROTEIN 5A	Interproscan

Gene Ontology

No Gene Ontology signature was detected for KXJ29892.1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24510	VWA5; von Willebrand factor A domain-containing protein 5	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ29892.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

68TPM > 0

2Conditions

52.4Max TPM

27.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	34	31.43	52.44
whole animal · symbiotic	36	34	23.87	40.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	52.44
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	52.25
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.92
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	43.46
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	41.21
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	39.44
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.76
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	38.47
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	37.97
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.48
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.47
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	36.16
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.56
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.45
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	35.23
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.97
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	33.86
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	32.88
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.97
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	31.79
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	30.68
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.89
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	29.74
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	28.90
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.86
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	26.28
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.72
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.51
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.22
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	25.20
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.32
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	23.14
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	22.11
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	21.36
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	40.04
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.85
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	38.49
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.66
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.54
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	36.25
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	35.35
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	34.39
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.60
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.45
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	30.31
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	29.92
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	28.80
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	28.47
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	25.07
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	22.12
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.64
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.33
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.26
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	21.08
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.95
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	20.27
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.76
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	19.00
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.94
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.57
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.46
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	18.33
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.61
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.16
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	17.14
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.25
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	16.06
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.25
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.